J1b M365+

Neanderthal

2011-12-23T11:09:00.001-08:00

By 23andme I am 2.7% Neanderthal !

https://23andme.https.internapcdn.net/res/pdf/jZxKxwC6liHimK59hqd1HQ_23-05_Neanderthal_Ancestry.pdf

Europeans will have a "bigger" proportion of Neanderthal DNA than Africans, as we can observe in the comparison !

23andme Relative Finder. New Cousin !

2011-12-23T10:37:00.000-08:00

My Clan

2011-12-13T15:37:00.001-08:00

My Clan:

Picture of the family Gomes de Oliveira from Joinville, Santa Catarina, in 1923. The older lady is my (Ricardo Costa de Oliveira) Great-Great-grandparent Rosa Leocadia Gallo Machado, born 1830, widow of João Gomes de Oliveira (1824-1892). On his side are four of their children. On the left side (pictured) is his daughter Rosa Gomes de Oliveira married to Antonio de Oliveira Mira, parents of Crispim Mira famous writer from Santa Catarina. On the left we have João Gomes de Oliveira (son), Vereador in Joinville and Captain of the National Guard (paternal Great- grandfather of Ricardo Costa de Oliveira). On the right side of Rosa Leocadia we have Procopio de Oliveira Gomes, Deputy and Mayor of Joinville, married to Mary Balbina de Miranda. On the right side of Procopio we have Clemencia Gomes de Oliveira, who married Francisco Jose Ribeiro, Vereador in Joinville. Upstairs, in the center (under an arrow and the number 3), is Placido Gomes de Oliveira, MD, State Representative, son of Procopio. By his side (number 4) is Carlos Gomes de Oliveira, Senator, cousin and son in law of Procopio. Carlos Gomes de Oliveira lived more than 100 years and he was the president of the Brazilian senate in 1955. He represented Brazil and spoke at the United Nations in 1957.

Landscapes of my Y DNA

2011-12-10T03:31:00.000-08:00

Landscapes of my Y DNA in Northern Portugal and in Southern Brazil

My Paternal line came from Guilhado, Milhazes, Barcelos to São Francisco do Sul in the first years of the 18th Century.

Manoel Gomes Galhardo was baptized in Milhazes, Barcelos, Portugal in 22/Dec/1686

He became a Captain and a big landowner in Brazil

Sesmaria de Manoel Gomes Galhardo, Rio Areias Grandes, Terra Firme da Ilha de São Francisco do Sul, Santa Catarina, in Brazil

4th Great-Grandfather (1718-1792)

Region of the Farm of my 2nd great-Grandfather João Gomes de Oliveira (1824-1892). Rio Cubatão, Pirabeiraba, Joinville. On the 5th of February of 1882 the Xocleng Indians attacked the farm and João Gomes de Oliveira and his Black Slaves had to resist. That was the last attack of the Natives to the family property.

Kolonie Zeitung, o jornal em alemão de Joinville:
"No domingo, dia 5 deste mês (fevereiro/1882), os bugres invadiram a nova fazenda do Sr. João Gomes de Oliveira. O proprietário retirou-se da propriedade na noite anterior, com sua família e seus negros, porque estavam desarmados, mas retornaram no dia seguinte com armas.
Quando do seu retorno à propriedade, encontraram tudo destruído; as peças de cobre do alambique foram arrancadas e roubadas, todas as ferramentas em ferro, como machados e similares, também roubados, pipas de cachaça foram destruídas a machadadas. A plantação de milho foi danificada. Esta propriedade está situada a 17 km da cidade, aproximadamente em frente à Serraria do Príncipe, na outra margem do Rio Cubatão".

Joinville today. My Grandfather José Gomes de Oliveira was born here in 2/JAN/1896

The map of the Family in São Francisco do Sul, Joinville and some signatures in the 18th Century

I was born in 1964 in the Center of Rio de Janeiro, Ordem do Carmo, Lapa, exactly here:

J1b M365 is negative to Z1834

2011-12-10T03:23:00.000-08:00

The new J1 SNP Z1834 associated with J1 DYS388=13 is negative to M365. I tested with FTDNA and I am Z1834 negative.

J1 is a complex and diverse haplogroup. Ideologies, religions and identities are always related to the history of J1, so the sub-haplogroups are fundamental for the history and expansion of this decisive antique civilization-maker and religion-maker haplogroup

As November of 2011 we have:

J1* - Small pockets of STRs waiting for a SNP and for a history in Eurasia and Africa.

J1a - M62. Old SNP . A singleton found in a Crimean Tatar of Uzbekistan

J1b - M365. Originally found in Eastern Anatolia and in Georgia. Now we have two small hotspots in Northern Iran and in Western Iberia and thinly scattered cases in Devon, England, the French Pyrenees and in Belgium. The Caspian Iranian cases and the Portuguese-Brazilian cases are matching in more or less 2000 years, a historical TMRCA dating to the Fall the Roman Empire. Pretty distinctive modal haplotype associated to J1b and a basal branch of the J1 haplogroup. The distinctive J1b modal haplotype is usually associated with the Ancient Iranian languages and peoples in Eastern Anatolia and Northern Iran. A map with the J1b types:http://tinyurl.com/5owkuh

J1c - L136 and the big P58 group. The J1c3d (L147) is the traditional J1-Deep South usually associated with the Semitic imaginary. Monotheism, Deserts, Camels, Jews, Arabs et Caterva. Desinformed people will take this important J1 sub-haplogroup as the totality of the J1 experience, what is a mistake committed for begginers in genetic genealogy. J1d- Z11834 (plus more Z SNPs discovered in November of 2011) or the bulk of the DYS388=13 casesJim's Map of 388=13 http://tinyurl.com/nsww44
We can observe in Jim's map of J1 388=13 almost a precise straight diagonal line to the West of the Caucasus, Dagestan, Azerbaijan, Eastern Anatolia, Pontus, Armenia, Northen Iraq, Syria and Lebanon. To the East of this line J1 388=13 is rare in Northern Iran and in the Southern Caspian shores, where the rare J1b types can be found and 388=13 is also rare to the Southern semi-arid areas where the "Semitic" P58+ L147+ types are dominant. 388=13 is also present and thinly spreaded in Greece, Eastern Europe and parts of Western Europe. It looks like the three mentioned types of J1 (Z1834, L147 and M365) had a completely different history and a completely different pattern of migrations and expansions. They were not living together and they were not moving together because they are found in different places with different frequencies. The smallest and rarest SNP, J1b M365 is completely absent in several populations where 388=13 is found and L147 is dominant. In the detailed SMGF database there are only two J1b types hotspots: in Northern Iran and in Portugal, so J1b could be perhaps one of the elements in the individuality of the Portuguese language and Portuguese Empire in Brazil where J1b is regularly found in most of the regions. No J1b was found in the Mediterranean Sea. Probably Z1834 participated in all the ethnic and political movements across the Z1834 divide line to the West, since the Neolithic, the Bronze Age, the Persian Empire, the Eastern Roman Empire, Byzantium, the Ottoman Empire. Tests with the 1000 Genomes Project also revealed that Z1842+ would be J1d1 !

The “J1b type” is thinly scattered around Western Europe

2011-10-16T07:05:00.000-07:00

Another “J1b type” singleton (up to the moment) in the French Heritage Project
Laborde
http://www.familytreedna.com/public/frenchheritage/default.aspx?vgroup=frenchheritage&section=yresults

France J1 13 22 15 10 12-18 11 15 12 13 11 29 19 8-9 11 11 25 14 20 25 14-15-16-16 10 9 21-21 15 13 18 17 33-35 12 10

Laborde is a French surname heavily concentrated in the French Pyrenees

Why the “J1b type” Ley, from Devon, England is a “singleton” and the same can be observed in relation to Laborde, from France ?
It seems that the “J1b type” is thinly scattered around Western Europe with the two unrelated cases in Devon and probably in the French Pyrenees ?
Why there’s a small frequency but at a regular rate of the “J1b type” in Western Iberia, mainly in the Portuguese populational stock ? I can find the “J1b type in almost all Brazilian regional samples at the frequency of 0,5%, from the West to the East, from the North to the South of Brazil ? It seems that the “J1b type” was present since the foundational stock in the Minho, the cradle of the Portuguese population around the year 1100, so the advance of the Portuguese frontier in the Reconquista and in the conquest and colonization of Brazil would spread the “Portuguese J1b type” at a regular rate.
Another point is the estimation of the TMRCA (Time to Most Recent Common Ancestor) of the “J1b types in Iran, Portugal, France and in England ? The TMRCA is practically the same around 1500 years (more or less), as we can see in the Mcgee Y-utility
The question is how the “J1b type”, a small clade found only in Eastern Anatolia-Georgia-Northern Iran and the Caspian adjacencies arrived in Western Europe around the year 400 ?
The Arthurian Legends had the steppe component from the Caucasus, probably a group of haplotypes from that part of the world could arrive in Western Europe around the period of the Fall of the Roman Empire, a window of opportunity linking the Atlantic with the Caspian Sea, not only the possible “J1b types”, but also Caucasian types of the G haplogroup and others could had arrived in that conjuncture. The fact is that the “J1b types” had a common ancestor somewhere close to Northern Iran 2000 years ago because the structure of the matches between the Western European “J1b types” and the Iranian “J1b types”. The TMRCA is quite close to 1500-2000 years and there’s a starlike type of expansion of all “J1b types” since then. So some of the legends in Western Europe could perhaps be connected with the Iranic-type of knights and mercenaries present in Western Europe in that time ? Some wrote about the Sarmatians but the Alans could be a good candidate for the extinct Iranic groups that could reach Western Europe by the fall of the Roman Empire as the source of the Western European “J1b types “ ?

"J1b type" from England ?

2011-10-15T08:18:00.000-07:00

One "J1b type" haplotype from Devon, England

FTDNA 211891

I have been analyzing all J haplotypes published in every public database or article in the last five years.
We have found the “J1b type” in Northern Iran and in Western Iberia. Now we have the first English candidate.
I have never found any “J1b type” in the Mediterranean area and no Jew or Arab FTDNA Project had any “J1b type”.
The Iberian and Portuguese haplotypes have more proximity than the Iranian haplotypes.
I tried to use the Mcgee Y-utility. I would give more centuries to the calculus there, but there’s an idea about the temporal connections there.
The English haplotype is equidistant between the Iranians and the Iberians !
The TMRCA time to most recent common ancestor can be related to 1500-2000 years ago, the period of the Fall of the Roman Empire, when the Eastern Barbarians arrived in Western Europe, so the Iranic Alans conjecture looks like a good hypothesis in my opinion !

J1b type. From the Caspian Sea to Mato Grosso do Sul, Brazil

2011-07-10T07:08:00.000-07:00

New YHRD release N° 37.
Another J1b type was found in Mato Grosso do Sul, Brazil. One in 50 (1/50). Keeping the same ratio observed of more or less 0,5% of J1b's types in any Portuguese speaking sampled populational stock tested. As always any Brazilian sample is showing the J1b types at the same proportion already observed.

Mato Grosso do Sul, Brazil and the Caspian Sea !

19 389i 389ii 390 391 392 393 385 438 439 437 448 456 458 635 ygatah4

15 13 29 22 10 11 13 12,19 10 11 14 20 15 18.2 21 10 - Mato Grosso do Sul

15 13 29 22 10 11 13 12,20 10 11 14 20 15 18.2 21 10 - Rasht - Gilaki, Iran

Mato Grosso was the farthest frontier of the Portuguese and the Brazilian Empire. In the 18th century a travel from Lisbon to Macau, in China, was shorter and easier than the trip to Mato Grosso, the continental heartland of South America. A very difficult trip facing some of the most fearsome Amerindians from Brazil always ambushing the explorers. Only the Brazilian Bandeirantes could conquer that remote frontiers fighting the natives, the animals, the diseases, the tropical dangers and the Paraguayans from the Spanish Empire in the big tropical swamps upstream of the Spanish controlled Paraguay River. The cost worth the prize because nowadays Mato Grosso is the world's biggest producer of soybean and bovine meat, full of empty spaces in the Northern Cerrados.

As I have predicted here, the Brazilian J1b haplotype constitutes approximately +/- 0,5% of any sample of the Brazilian population descendant from the old Minho's frontier in the Christian Reconquista.

Caucasian J1(xP58)

2011-05-15T07:07:00.000-07:00

Parallel Evolution of Genes and Languages in the Caucasus Region
Oleg Balanovsky et al
Mol Biol Evol (2011) doi: 10.1093/molbev/msr126

J1 is the major haplogroup in the Caucasus with the most complex and diverse phylogenetic network in the region. Of all the major Caucasian haplogroups (G2a3b1, G2a1a, J2a4b), J1 (xP58) is also the most frequent haplogroup present around the Caspian Sea and the most frequent in Northern Iran. Other J1 (xP58) SNP like J1b M365 is a Northern Iranian haplogroup forming a distinct cluster with the Western European, Western Iberian Portuguese-Brazilian J1b haplotypes, what possibly can be a genetic testimony of a section of the Iranian-speaking Alan presence in Lusitania and Northwestern Iberia, well attested in historical documents and plausible in terms of their TMRCA in the Atlantic and the Caspian shores.

Singlarities of the Brazilian J1b cluster

2011-04-22T14:18:00.000-07:00

Singularities of the Portuguese-Brazilian J1b modal and DYS frequencies in the entire SMGF database

393= 13 - 70,981%
390=22 - 11,352%
19=15 - 23,930%
Three common markers but in sequence - 13-22-15, they are very rare in the J1 haplogroup results. Only the J1b cluster in the FTDNA J Project J1’s clusters have that sequence.
385 a/b = 12/19 - 0,147% (rare markers, just like 12/20 - 0,167%)
388=16 - 1,677% (associated with the J haplogroup)
458=18.2 - 0,375% or 17.2- 0,539% (.2 functions almost like a J1 SNP)
459=8/9 - 17,077%
GATA H4.1 = 9 - 0,252% (very rare)
YCAII=21/22 - 1,187% (rare)
461=10 - 1,187% (rare)
635=21 - 21,159% (marker very present in mini-haplotypes from articles and in the YHRD base)

The modal:
Four Iranian haplotypes Shahroud, Astane, Abadeh and Tehran.
Two Brazilians and one Reunion Island of Portuguese origin and the new haplotype from Peru.

The longest distance from the modal is found in the two extremes, the Iranian from Shahroud with the genetic difference of 29/36 and the Iberian-Peruvian, with the same genetic distance of 29/36 from the proposed equidistant modal.

Shahroud, Semnan, Iran - Match of 29/36

Markers Generations Years
Most Likely TMRCA more than 50 generations - more than 1550 years.
25% Cumulative Probability: 43 generations - 1333 years.
50% Cumulative Probability more than 50 more than 1550.
75% Cumulative Probability more than 50 more than 1550.

León D. from Peru- Match of 29/36

Markers - Generations - Years
Most Likely TMRCA more than 50 generations - more than 1550 years.
25% Cumulative Probability: 44 generations - 1364 years.
50% Cumulative Probability more than 50 more than 1550.
75% Cumulative Probability more than 50 more than 1550.

It seems that the J1b cluster slipped from the Roman Empire and evicted the Islamic Caliphate just crossing, crusading and fighting for survival against both enemies in the two distant and different edges (Caspian Sea and Portugal) at the end of both civilizations. The next step to the cluster was the Portuguese Seaborne Empire sailing and reaching places far more distant than the Romans and Arabs had ever been.
That's the complete SMGF modal sequence of the Portuguese-Brazilian/Northern Iranian J1b cluster.

New Talysh-Gilaki J1 cluster

2011-04-21T05:30:00.000-07:00

New Talesh or Talysh-Gilaki J1 cluster found in the Sorenson Molecular Genealogy Foundation (SMGF):

Modal:
393=12
390=22
19=15
385=13-18
388=15
458=18.2
YCA=19-22
461=10

Portuguese-Brazilian J1b and Northern Iranian modal:
393=13
390=22
19=15
385=12-19 or 12-20
388=16
458=18.2
YCA=21-22
461=10

The two Branches:

The Talysh-Gilaki cluster is a smaller and more homogeneous cluster in terms of STR, the estimated time to most recent common ancestor (TMRCA) is close to 1000 years. The J1b Portuguese-Brazilian cluster TMRCA is close to 1500 years and the united Portuguese-Brazilian+Northern Iranian branch TMRCA is more than 2500 years.

Historical sources can relate the Root to some Ancient Iranian peoples like the Cadusii, Dailamites(Deylamites), the Medes and the Alans of the South-Western Caspian areas.

J1a M62 is Crimean Tatar

2011-04-17T06:33:00.000-07:00

J1a M62 was reported by Ornela Semino et al - Origin, Diffusion and Differentiation of Y chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and later Migratory events in the Mediterranean Area. 2004. Am J Hum Genet 74(5) 1023-1034.

Table 2, 184 samples from Central Asia- 9,2% were J1 M267 and only one 0.5% was M62.

Peter Underhill, a co-author, told me that the M62 was found in one of 22 Crimean Tatars samples collected by Spencer Wells and mentioned in Well et al 2001 PNAS publication. It would be DYS388=13.

Via Alanica

2010-12-04T08:20:00.000-08:00

New Iranian haplotypes in the article “Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon”, Marc Haber et al.

324 Iranian haplotypes, 25 J1 and 2(324/2 = 0,61% - I171 and I174) have the rare J1 motif 19=15, 390=22, 393=13, 385a=12, DYS458.2) usually associated to J1b M365+
No Lebanese haplotype was found with the described modal.
The Iranian J1’s are mainly L136 negative and P58 negative, while the Levantine, Arabian and the North African haplotypes are mostly L136+ and P58+, so a big difference in terms of two big J1 SNPs of Northern/Southern difference.

So the possible general distribution of this rare J1 genetic signature is:
Y Search code

Iran
I171- 17 markers - WKQUE
I174 – 19 markers - 5F9HU
SMGF Iran (260/4 = 1,5%)
SMGF – 42 - Iraniano - Iran - Tehran SMGF – FSVWG
SMGF – 42 - Shahroud, Semnan, Iran - 9MS3E
SMGF - 42 - Abadeh Fars, Iran - XVMBC
SMGF – 38 - Astane - Iraniano SMGF –2Y5SH
YHRD (47/1) – Gilaki - Iran
YHRD – 17 - Rasht – Gilaki – Iran - QFBX9

Turkey
Haplótipo 168 - 9 – Turkey – YTHMV - J1b SNP tested
IGenea – 53 - Deregolic - Turkey - NR8VC - J1b SNP tested

Belgium
FTDNA – 12 - Cuylaerts - Turnhout, Belgium –- E9YYJ - J1b SNP tested

France
FTDNA – 12 - Laborde - 6HCM6. From a region close to the French Pyrenees with a town named Alan and memorials like the Hourquette d'Alans ?.

Spain
FTDNA – 67 - Dominguez Castro, Ourense, Galicia, Spain – PRJ9T - J1b SNP tested
YHRD – Caceres, Extremadura – Spain – 22RY7
Spanish Empire
YHRD – Guadalajara, Mexico - 49S86

Portugal
Haplótipo 389 (244/1) - 15 - Northern Portugal - 38EUZ
FTDNA – 67 – Sardinha, Ilha de São Miguel, Azores - K3SMV - J1b SNP tested
SMGF – 32 - Ferrere (Ferreira) – Migrant to Reunion Island - X6P7G
Portuguese Empire - Brazil
FTDNA – 67 - Oliveira – Brazil – 2CUZQ - J1b SNP tested
HP 406 – (481/1) – 17 – Brazil - CDYQR
YHRD – (247/1) – 10 – Alagoas - MFS67
SMGF Brazil (632/2 = 0,3%)
SMGF – 28 - Cordeiro de Melo - Santana do Livramento, Rio Grande do Sul - R7SHE
SMGF – 32 – Gonçalves - Imaruí, Santa Catarina - 6WQMH

Shared mini-haplotype
YHRD – 9 – mini-haplotype, matching three individuals from the Azores, Rio de Janeiro and Turkey - 6URZK

The connection is the possible Via Alanica. J1b was discovered in Eastern Anatolia and in Georgia but Ancient Iran was a possible source too. There’s a visible trail connecting Northern Iran with Western Iberia. The rare J1 motif (19=15, 390=22, 393=13, 385a=12, 458,2) usually associated to J1b M365+ is found at small but regular rates only in Iran and in Portugal, the two hotspots for this genetic signature, the hypothetic Western Alan J1b genetic signature. Isolated cases (like in Belgium and France) can be found inbetween the two hotspots of what was known as the Via Alanica. The Alans had several haplotypes and genetic genealogy has probably discovered one of them here.

The haplotypes
http://tinyurl.com/2aypyko

Bandeirantes & Indian Ancestors

2010-11-26T01:37:00.000-08:00

Another view from the first American experience in the 1500's
1 - The Amerindian genetic mark is a central element in the first and principal families of the American Continent.
2 - The Amerindian genetic mark represents the continuation of the old Amerindian structures of power and the formation of the main connections of antiquity in the land as a high status symbol of the new American nobility or American gentry created in the New World.
3 - Tribal daughters, named and documented real Amerindian "princesses", were the key element, the zero degree point of the American conventional genealogy. The conquerors, founders and the first colonists in the making of America in the 1500's and 1600's are listed, narrated and described in the oldest written genealogies.
4 - The demographic explosion of the first American settlers. The territorial expansion and the big mass European migration. The Amerindian genetic mark became a genetic souvenir and a heritage. As the article said: "We don't look Indian by any means, but to feel that, you get a sense of how varied and rich your culture can be..."
5 - The Europeization of the American population. The first mixed American Elite related to tribal chiefs and the first navigators and discoverers is the social, economic, ethnic, political, cultural and moral basis of the new ruling class. The first families and the land are one.
6 - It's extremely rare to keep the first Colonial founder Amerindian mark in the subsequent Europeization of the continent. The Europeization of the entire population as in parts of North America, Southern Brazil, Argentina, Uruguay or the Europeization of the elites as in some parts like Rio de Janeiro. After five centuries of European migration to America only some endogamic social groups can keep and preserve a small amount of the first Colonial Amerindian autosomal DNA (detected as 1-4% in labs like 23andMe) or keep Amerindian mtDNA structured from long matrilocal lineages of the first American historical power elites. That's the original Amerindian mtDNA coming from the Casa Grande, the matrons, the matriarchs, the old American dames with very ancient and deep roots in the land and established conventional genealogies in the elites.
7 - The colonization of Brazil and the creation of a new authentic Brazilian warrior nobility/elite of mixed origins, the Bandeirantes from São Paulo de Piratininga, where the pre-Columbian tribal Tupi chief Tibiriçá is buried under the crypt of the oldest and most important temple of the city of São Paulo, the first family and the first genealogy of Salvador da Bahia, os Caramurús and the mixed family of the Albuquerque Maranhão, from Pernambuco. All had extreme high status ranking in the Portuguese Empire and they were the Comandos of the military expansion of Brazil in wars against the Spanish, French and Dutch Empires in the incessant South American wars of the 1500's, 1600's and 1700's. Perhaps Pocahontas in Virginia, North America, could have a similar history to the raising of the Brazilian Colonial elite. In Mexico, Quebec, Paraguay and in other parts similar social Euro-American elites had been created with more or less success in the creation of new ethno-national States in the American continent.
8 - In the early 1800's the slaver aristocratic project of the Ancient Regime survived only in Brazil, in the Southern United States and in some remanescent islands of the Spanish Empire like Cuba and Puerto Rico. In the 19th century only Brazil kept the African traffic until 1850 and the slavery until 1888. After the ancient power of Imperial Rome, Imperial Brazil was the world's biggest slaveholder society ruled by a new local nobility and a new population created with big Amerindian and African populational stocks.
9 - Anyway the small Amerindian component is a must to a classical Brazilian genealogy coming from the 1500's, 1600's, o "Sainete Brasílico" is a comprobatory document for the Brazilian old stock "Quinhentão".

Sometimes the Brazilian Amerindian mtDNA could get access to the top Nobility in Portugal too. The Marquês de Pombal, an 18th century Portuguese powerful statesman had a Brazilian Amerindian mtDNA from the early 1500's (Genealogias Clássicas). He was related to Pernambuco's Albuquerque de Maranhão family, a top mixed family from the first Brazilian nobility, Conquistadores do Maranhão. The Marquis of Pombal abolished the differences between Old Christians and New Christians and he abolished or diminished the Amerindian slavery in Brazil and recognized the Indians as subjects of the Empire

Rarity and nobility in the Old and New World ?

2010-11-26T01:35:00.000-08:00

There’s a possible and necessary connection between rarity and nobility in Western Europe. If the genesis of the European historical nobility is related to ethnic war in the fall of the Western Roman Empire, as certain documentation or imaginary prescribes, so a deep history of the European social stratification would be revealed in terms of distinct STR-SNPs. Or the European social structure is completely randomic in terms of the STR-SNP distribution or there’s a historical structure of political differentiation in the formation of the European demographics, perhaps not randomic but not as rigid as the DNA differentiation of the Indian castes. The supposed DNA of Louis XVI is a showcase under investigation. If the conventional genealogies of the royalty were correct (what is doubtful in several cases), the relative rarity of the “royal” lineage is a documented fact. The political action of elites can shape ethnic, national, linguistic, cultural or religious identities. We can assess the demographic impact in Europe and in America of “New” European groups, with some distinct genetic profiles, like the Jews and Roma (Gypsies) with very interesting histories. Conventional Genealogy Degree Zero is a good starting point. What is narrated of the origins of the first nobility ? In Portugal the first documented genealogy, O Livro Velho das Linhagens, described the principal family of the Sousãos in the heart of the Minho, coming from Uffo Belfager (most probably an old Suebi name), a man that lived in the 800’s. Another decisive lineage was the Bragançãos, from the strategic territory of Bragança. The founder was D. Alam, the kidnapper of an Armenian Princess. The legends and references are clearly situated in the stronghold of Bragança as a supposed Alanic lordship that enabled the creation of the Kingdom of Portugal, the first ethno-national State in Europe with a continuous history. language and political frontier. Brazil has been the most aristocratic society in the New World, a new territory and a new frontier where the Ancien Regime planted deep roots. Brazil created a new local nobility and reproduced the old social structures. The Brazilian D. Pedro II would had the same Y DNA of Louis XVI. Not only the top-top European pedigrees have been in Brazil, but we can try to recognize and detect the DNA impact of the outsiders of the Roman Empire, groups like the Jewish and Roma contributions and especially other “exotic” groups arriving in Iberia as invaders and conquerors. The old Brazilian Colonial Elite had a unique genetic profile in the world, mostly composed by Portuguese and other European (Southern and Northern) contributions with small and distant, but regular Amerindian and African little segments. No other American Colonial Elite has had exactly the same genetic profile, the same history, the same proportions, the same expansion and the same number. It’s a Brazilian demography, the product of a specific aristocratic society of the Ancien Regime. The Brazilian mtDNA is the closest thing to a “racial democracy” in the world. The assimetry of the Brazilian mtDNA with the Brazilian Y DNA, the creator of the Brazilian state-society in terms of the preservation of the same language, religion, political institutions, army and the responsibility of the conquest and colonization of the big Brazilian territory. Mestiçagem is mainstream in Brazil and that’s a positive value. The Suebi and Alans were an integrant part in the formation of the Portuguese-Brazilian people. A region without diversity as in the case of a big concentration of R1b only, would not be able to create a proper independent or autonomous nobility and those places would not be able to keep and create a proper ethno-national State (and later to build up an own Empire) with it’s own institutions and language, what happened in parts of the Western Atlantic high % R1b façade, in places and regions where the R1b native peasantry were almost total without an internalised outside warrior nobility.
The Portuguese Suebi DNA will match some Northern European regions. The Portuguese Alan DNA would be exceptionally rare.
Why Y DNA J1b and others eventually can be related to the Alans in the Portuguese-Brazilian male stock ?
1 – Extreme rare haplogroup and extreme rare haplotypes. Almost total isolation in Western Europe. An exotic Caucasian-Caspian Northern Middle Eastern island in a sea of Western Atlantic Iberian R1b P-3122 – The source area was located in the Caucasus, Eastern Anatolia, Armenia, Caspian Sea. They came far from the East to the extreme West without a connection with Jews (Judaism) or Arabs (Islamism), both also integrated and incorporated in the Portuguese and Brazilian populations in different waves.3 – No close matches outside of the ethnic group. Outside the Portuguese-Brazilian haplotypes, the closest combination is found only within certain Northern Iranian populations4 – The temporal distance of the STR genetic distances separating the Portuguese-Brazilian cases and the Iranians is estimated between 1600-2000 years5 - Relative reproductive success and verifiable regular frequencies in any population of Portuguese-Brazilian origin at regular rates.
6 – Status quo and longue durée of the exotic DNA ? Yes or no ?

23andMe. My Son

2010-08-28T16:37:00.000-07:00

2 Oliveira - Son
Y DNA J1b - Milhazes, Barcelos, Portugal. 300 years in Santa Catarina, Southern Brazil
mtDNA N1b1 -Kreshnik, Lublin, Poland. Catholic. Three generations in Curitiba
Brazilian Ancestry Painting

23andMe. My Father

2010-08-28T16:27:00.000-07:00

1 Oliveira - Father
Y DNA J1b - Milhazes, Barcelos, Portugal. 300 years in Santa Catarina, Southern Brazil
mtDNA C1c - Probably Guarani, Paranaguá, Litoral do Paraná
Brazilian Ancestry Painting

New 23andMe Ancestry Finder

2010-07-24T06:49:00.000-07:00

Another fantastic tool, the New 23andMe Ancestry Finder

My results (as released in july of 2010):

Default - starting point
Portugal : 0,4%

All included:

United States 4.3%–8.2%
Portugal 0.6%–1.1%
United Kingdom 0.4%–1.0%
Ireland 0.4%–0.8%
Spain - 0.4%–0.7%
Colombia 0.7%
Poland 0.3%–1.0%
Hungary 0.2%–0.3%
South Africa 0.2%
Netherlands 0.2%
Romania 0.1%–0.3%
Brazil 0.1%–0.3%
Ukraine 0.0%–0.7%
Latvia 0.0%–0.7%
Russia 0.0%–0.5%
Lithuania 0.0%–0.4%
Germany 0.0%-0.4%
Switzerland 0.0%–0.3%
Panama 0.0%-0.3%
Italy 0.0%-0.3%
Indonesia 0.0%-0.3%
France 0.0%-0.3%
Argentina 0.0%-0.3%
Venezuela 0.0%–0.2%
Norway 0.0%-0.2%
Canada 0.0%–0.2%
Peru 0.0%–0.1%
Denmark 0.0%-0.1%
Belarus 0.0%–0.1%
Uruguay 0.0%–0.0%
Ecuador 0.0%–0.0%

11,6cM - 4 United States chr10
9,4cM – 4 United States chr13
9,2cM - 2 Unknown, 2 United States chr14
8,4cM – 1 Argentina, 1 United States, 2 Unknown chr6
8,3cM - 4 Portugal chr21
8,3cM – 1 Portugal, 3 United States chr3
8,3cM – 2 Germany, 1 France, 1 United Kingdom chr22
8,3cM – 2 United States, 2 Canada chr13
7,9cM – 4 Portugal chr1
7,4cM – 4 Ireland chr13
7,1cM – 1 United States, 1Denmark, 2 Unknown chr22
7,0cM – 1 Venezuela, France, 2 Spain chr18
6,9cM – 1 Ireland, 2 Unknown, 1 United States chr5
6,8cM – 4 United States chr2
6,8cM – 2 Lithuania, 1 Russia, 1 Lithuania chr7
6,7cM – 1 Uruguay, 3 Unknown chr21
6,7cM - 4 Romenia chr11
6,6cM - 4 Portugal chr4
6,6cM – 2 United States, Indonesia, Switzerland chr11
6,6cM - 2 Unknown, 2 Russia chr19
6,4cM – 1 Panama, 3 Unknown chr20
6,3cM - 1 United States, 3 Unknown chr1
6,3cM – 1 Lithuania, 3 United States chr5
6,2cM – 4 Netherlands chr1
6,2cM – 4 United States chr20
6,1cM – 4 Portugal chr1
6,1cM – 4 Colombia chr3
6,1cM – 2 Germany, 2 Portugal chr20
6,1cM – 4 Spain chr1
5,7cM - 4 United States chr8
5,6cM – 1 United States, 1 Norway, 2 Italy
5.6cM – 2 Ecuador, 2 United Kingdm chr22
5,6cM – 2 United Kingdom, 2 United States chr8
5,6cM – 3 United States, 1 Unknown chr1
5,5cM – 2 United States, 1 United Kingdom, 1 United States, chr9
5,5cM – 4 South África chr11
5,5cM – 1 Russia, 3 Unknown chr2
5,4cM – 4 United States chr18
5,4cM – 1 United States, 3 Unknown chr22
5,4cM – 4 United States chr12
5,4cM – 4 Poland chr11
5,4cM – 1 Spain, 1 Unknown, 2 Spain chr11
5,3cM – 2 United States, 2 Unknown chr14
5,3cM – 1Unknown, United States, Ireland, United States chr8
5,3cM – 1 Brazil, 1 Unknown, 1 Peru, 1 Unknown chr2
5,2cM – 1 Latvia, 2 Poland, 1 Ukraine chr16
5,2cM – 2 Hungary, 2 United States chr11
5,2cM – 1United States, 1 Unknown, 2 United States chr9
5,2cM – 4 United States chr1
5,1cM – 4 Ireland chr13
5,1cM – 4 United States chr5
5,1cM – 4 Poland chr4
5,1cM – 1 United States, 1 Unknown, 2 United States chr3
5,1cM – 1 Unknown, 3 United States chr1
5,0cM – 4 United States, chr10
5,0cM - 2 Belarus, 1 United Kingdom, 1 Romania chr8
5,0cM – 4 United Kingdom chr2

5cM = 4 grandparents from the same country
Portugal 0.9%
Spain 0.4%
Ireland 0.4%
Poland 0.3%
United Kingdom 0.2%
Romania 0.2%
Netherlands 0.2%
Hungary 0.2%
Colombia 0.2%

Indicated segments declared to be of Ashkenazi Jewish ancestry.

The Origin of the Brazilian Y DNA

2010-07-24T06:19:00.000-07:00

The Origin of the Brazilian Y DNA

Alagoas, Brazil Y DNA (STR-SNP) at the YHRD release 34.

I’ve made a comparative analysis of the continental Portuguese Y DNA with the regional Brazilian/Alagoas one.

Sources:

Analysis of Y chromosome SNPs in Alagoas, Northeastern Brazil (Dalmo de Azevedo:2009), 247 tested

Micro-Phylogeographic and Demographic History of Portuguese Male Lineages (Sandra Beleza:2006), 657 tested

Portugal / Alagoas, Brazil
E (xE3a, E3b1) 0.5% / E(xE1b1a-B ) M96 0.4%
E3a 0.2% / E1b1a M2 4.45%
E3b1 (xE3b1-c) 0.9% / E1b1b1(xE1b1b1a-c) M35 0.4%
E3b1a 4.1% / E1b1b1a M78 5.67%
E3b1b 5.6% / E1b1b1b M81 4.05%
E3b1c M123 1.2% / E1b1b1c1 M34 0.4%
F (xGIJK) 0.2% / #
G 5.5% / G M201 3.64%
I (xI1b2) 6.1% / I(xI2a2) M170 4.86%
I1b2 1.5% / I2a2 M26 1.62%
J (xJ1d,J2) 3.4% / J(xJ2) M304 6.07%
J2 7.0% / J2 M172 7.29%
K2 1.6% / T M70 4.05%
L 0.3% / #
R1a 2.0% / R1a1 M17 0.4%
R1b3 (xR1b3f) 57.7% / R1b1b2 M269 55.47%
R1b3f 2.2% / #
# - Q1a3a M3 0.81%
# - K(xL,P,T) M9 0.4%

The proportion of the Y DNA structure between the two populations (samples) is remarkable, almost a mirror. The differences can be found in the Amerindian Q and the African E1b1a in the Brazilian admixed population.

The proportions are curiously regular because my own J1b haplogroup/haplotype is usually found at 0.5% in any big sampled Portuguese stock tested, that’s the case here, one probable J1b (1 of 247) present in the YHRD/Alagoas samples. 19-15, 390-22, 393-13, 385-12~18, 458-18.2

Other contributions to the Alagoas’ Y DNA stock:

- The Amerindian local population, the Caetés, a Tupi group, antropophagus, man-eater, they ate the first Bishop in Brazil after a shipwreck, Dom Pero Fernandes Sardinha (Évora, 1496- Alagoas, 1556). The source of the surviving Q1a3a-M3

- The Dutch occupation of Alagoas, 1637-1646. The WIC Geoctroyeerde Westindische Compagnie. After several battles and the final siege and defeat of the Dutch WIC Fort Maurice in 1645, thousands of soldiers and mercenaries from the Netherlands, France, Germany, Poland, England, Scotland and Jew traders (several Portuguese Sephardim and some Eastern European Ashkenazim, the first documented in Brazil) fought in Alagoas and were captured. The Inquisition freely released the Alagoas’ Ashkenazis in Europe because only baptized Catholics could be processed). After years of occupation and war some of that WIC DNA was incorporated in the local population ?

- The Quilombo dos Palmares, the biggest African community of escaped slaves in the New World. The fortified African citadel in the mountains of Alagoas resisted for almost a century until the final destruction in 1695. Another possible source of African DNA.

The Brazilian traditional colonial Y DNA is the Portuguese “age of sail” Y DNA and the modern Portuguese Y DNA is more related to the old “rural” Y DNA. I think a more or less homogeneous structure of the Portuguese Y DNA stock was already coalesced around the creation of the first Kingdom of Portugal by the year 1150. The moving frontiers in Western Iberia and in South America were the result of the action of a more or less homogeneous Y DNA set or a common pack of Y DNA conquering and colonizing new lands since then. May be a sort of an old diffused aristocratic-slaver cultural ethos or I don’t know what ? Definitely some of the old Alans, Suebi, Gallaeci, Lusitanians, Moors were still riding in new spaces with the Caravels and the Bandeirantes !

The Quest for Fatherhood

Genetic genealogy is rewriting the World History. The Brazilian slavery was the main reason of existence of Colonial Brazil. The growth of the Brazilian population is one of the biggest demographic world facts in the last hundred years. The Brazilian fertility rate created the last world population reaching the 200 millions people club. Brazil had a relatively small population in the world scale until the 1900’s. The main motor of the Brazilian populational expansion has been the Y DNA of the Medieval First Portuguese Kingdom. The Atlantic seafarers and continental conquerors of Brazil created a new population. Our old empire was the first national state to reach Sub-Saharan Africa connecting again Mankind after 60.000 years of separation. The new continent of America began to be colonized with a new population in 1500. In some Brazilian social groups we can find the perfect distribution of mtDNA in equal shares of a third Amerindian, a third European and a third African. Results are consistent with historical records of the directional mating between Portuguese males and Amerindian or African females. The Portuguese Empire only could do it to survive as a national state and national language with a big world empire. Just comparing Portugal with Scotland and Ireland or with the Basques or Catalans that could not escape the centripetal forces of England and Castille. The slavery and the organization of the Brazilian society can be compared with some posterior models. A comparison of the African DNA and the Black social role in Brazil can be compared with the experiences of the French in Haiti, the British in Dixie, the Boers in Africa and the Spaniards in Cuba. Brazil was by far the biggest importer of Africans to the New World (approx. 40% of the total of 10 millions).

Who are the Black Brazilians in terms of Y DNA?

The Y DNA. Number of declared Black tested people and proportion of European Y DNA:
120/60 – 50% . Source- BBC-Brasil site - Sérgio Pena

Genetic signatures of parental contribution in black and white populations in Brazil. Guerreiro-Junior.
Northeast – 89 - 34%
Southeast – 288 – 43%
South - 55 – 56%

Y-STR diversity and ethnic admixture in White and Mulatto Brazilian population samples. Luzitano Brandão Ferreira.

Mulattoes 50/46 – 93%

So the Brazilian Black and Mulatto population is in a good proportion an extension of the Medieval Portuguese Masculinity and adding the declared White Colonial population Brazil is the “center” of that Y DNA Manhood in genetic numbers. So we can understand a lot of things. I can write later.

Haplotypes and Empires

As I have written before, haplotypes are social facts. By a social fact, Emile Durkheim, one of the fathers of modern sociology, is referring to facts, concepts, relations, expectations that come not from individual realities, but that come from the social group which socializes and structures each of its members. Haplotypes are also political facts. The distribution of haplotypes in a population is a historical process related to social and political facts. How the class structure and the distribution of haplotypes in a society have been formed is a central question. The sociology of Karl Marx can be interesting in terms of the formation of the class structure of a society in economical, political and historical terms. The social, historical and political aspects of the distribution of haplotypes is a condition to understand the spatial distribution of haplotypes.

The world wide distribution of my haplotype can be an example. The small and extremely rare Y DNA J1b M365 was originally found and discovered in Eastern Anatolia and Georgia in 2004. As an “old” Anatolian SNP it has never been reported in South Eastern Europe or in the Balkans. So it seems that the the Turk expansion and the Ottoman Empire just bypassed (and eroded) J1b in that region. The same had happened before when the Mongols swept through Central and Eastern Anatolia. No J1b has never been found in the Levantine region and no J1b has been reported in the Eastern Mediterranean area. Also it seems that there’s absolutely no connection of J1b with Semites. The only private tester publicly reported as J1b in Eastern Turkey is a Zazaki speaker, a Northwestern Iranian language. I have discovered and reported the existence of two J1b clusters in Western Iberia, Portugal and in the Caspian shores of North Iran analyzing my own results from FTDNA and the SMGF, YHRD databases. The two clusters are connected by approximately 1500 years and they can easily be recognized at the Sorenson SMGF database with a quite distinct J1b root haplotype. In some centuries J1b could expand and develop a good demography in order to be a statistical phenomenon, a genetic and social fact, detected at the Portuguese stock population at regular rates close to +/- 0,5% in any collection of Portuguese haplotypes. So the original founder, the Genearch of the Portuguese speaking J1b was apparently a successfull survivor. In the last thousand years the Proto-Portuguese, mainly the Christian population from the Entre-Douro-e-Minho has passed from an almost exterminated Northwestern Iberian Christian “tribe” to being able to build the first world wide maritime Empire into a new thriving Ethno-National State with a new demographic explosion in Brazil. New rich genetic admixtures were made. In spite of the small databases at FTDNA, SMGF and several articles, we can infer from regular sampling that J1b is more present on the frontiers of the old Portuguese Empire than in Continental Portugal. At YHRD J1b is among the most common haplotypes in the Azorean sample. J1b can be found in the SMGF Southern Brazilian haplotypes and even in the tiny Reunion Island, in the Indian Ocean ! No J1b has ever been found in the important and well sampled Hispanic population from the United States, what means that J1b is almost non-existent in Mexico, Texas, California, Puerto Rico, for instance. In the case of the Azores and Colonial Brazil, the Portuguese conquest and colonization was mainly conducted by a kind of “fronteiro”, frontiersman, coming mostly from the Minho, Northern Portugal. The Portuguese frontier against Islam in Northern Iberia was transplanted to South America and to Brazil in a secular (existing or continuing through ages or centuries) process of expansion still raging in the Amazon. There’s probably an explanation to the fact that J1b is found thinly but regularly well spreaded (and well above the Portuguese European continental rates as given by the available data) in the old Portuguese world wide Empire and adjacent regions. The Atlantic was a gate to success because on the other shore of the Ocean everything was bigger and everybody could be richer in comparison with the source regions of the Colonials in Portugal. Perhaps the class position, the social status or the geographic location of some haplotypes in the early years of the formation of the Portuguese population was relevant. It was a movement within the same Empire, within the same religion, language and culture. The social, political and geographic place of J1b and several other different Portuguese haplotypes could be decisive as contributors in the making of the Luso-Brazilian frontier in the last thousand years, what can be a factor to explain the current distribution of this small clade in the world nowadays.

Genealogy is just a Historical SNP trail

2010-07-03T07:10:00.000-07:00

Genealogy is just a SNP trail

Let's compare the SNPs leading to J1b and R1b-P312 as july/2010
http://ytree.ftdna.com/index.php?name=Draft&parent=root

IJK L15, L16
IJ P123, P124, P125, P126, P127, P129, P130
J 12f2a, 12f2.1, M304, P209, L60, L134
J1 M267, L255
J1b M365

IJK L15, L16
K M9 , P128 , P131 , P132
P 92R7 , M45 , M74 , N12 , P27.1 , P69 , P207 , P226 , P228 , P230 , P235 , P237 , P239 , P240 , P243 , P244 , P281 , P282 , P283 , P284 , P295
R M207, P224, P227, P229, P232, P280, P285
R M306
R1,P? (ISOGG: R1,P) M173, P231, P233, P234, P236, P238, P241, P242, P245, P286, P294
R1b M343
R1b1 P25_1, P25_2, P25_3
V88
R1b1b P297
R1b1b1 M73
R1b1b2 M269, L265
R1b1b2a L23, L49
L150
(ISOGG: R1b1b2a1) L51
R1b1b2a1 (ISOGG: R1b1b2a1a,R1b1b2a1a) P310, P311, L11, L52, L151
R1b1b2a1b (ISOGG: R1b1b2a1a2) P312

Where are the missing SNPs leading to J1b ?

"A recently published study has used next-gen sequencing technology to resequence two Y chromosomes separated by 13 generations and discovered four single-base differences in 10 Mb DNA, suggesting that the Y chromosome euchromatin accumulates around one mutation per generation. Y-SNPs therefore now offer the best resolution of Y haplotypes and promise to distinguish almost every Y chromosome"

"Investigators have laboriously sought Y-SNPs shared by many individuals and have generally
paid little attention to the more numerous rare or individualspecific SNPs. Since there are around 24 million nucleotides in the euchromatic Y-specific section of the chromosome, there are
plenty of opportunities for SNP variation to occur. Next-gen sequencing technology allows entire Y chromosomes to be sequenced, so this vast potential resource can be accessed. Our
study compared two Y chromosomes from the same family separated by 13 generations [3]. These chromosomes were genotyped with the 67 Y-STRs mentioned above, and showed no
Y-STR differences. But sequencing them revealed four Y-SNP differences (Fig. 1). Detecting this small number of differences presented formidable technical challenges and more than 30,000
false positives had to be eliminated, including eight in vitro mutations that had arisen in the cell lines that formed the source of the DNA that was sequenced rather than in vivo within the
individuals. The four true mutations were confirmed by standard capillary sequencing of blood DNA from the same individuals, and three of the four by their presence in other members of the family".

The hare and the tortoise: One small step for four SNPs, one giant leap for SNP-kind
Yali Xue, Chris Tyler-Smith *
The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambs CB10 1SA, UK

If there's a new Y DNA SNP per generation approximately, we are going to have a festival of SNPs in the next years. Considering a generation of 30 years, in 900-1000 years of a lineage, we are going to find approx. 30 new Y DNA SNPs, more or less 30 SNPs in each millenium !

The dream of consumption of genetic genealogy ! A complete scan of the Y DNA will reveal the complete genealogy of a person.

J1b two clusters - Northern Iranian and Luso-Brazilian

2010-03-07T07:43:00.000-08:00

J1b M365 has a very rare Y STR motif. 393=13 390=22, 19=15, 385a=12, 388=16, 458=458,2 YCAIIa =21, YCAIIb = 22. I have found two geographically well defined J1b clusters. There’s the Western Iberian, basically a Portuguese cluster, Old Christian (Cristão Velho), Catholic, J1b cluster found in Portugal, Minho, Azores, Portuguese borders (Galiza, Extremadura) with a regular expansion and presence in Brazil. In the FTDNA J Y DNA Project the Western Iberian cluster is easily recognizable. The other discovered cluster has been the Northern Iranian cluster.

In 2009 Professor Klyosov kindly calculated the TMRCA
001_Portugal 13 22 15 11 12 20 11 16 11 13 11 30

005_Brazil 13 22 16 10 12 19 11 16 11 13 11 29

007_Belgium 13 22 15 10 11 17 11 15 12 13 11 29

009_Azores 13 22 15 10 12 19 11 16 11 13 11 29

010_Spain 13 22 15 10 12 19 11 16 11 13 11 29

012_Brazil 13 22 15 10 12 19 11 16 11 13 11 29

013_Ferrere 13 22 15 10 12 19 11 16 11 13 11 30

The J1b cluster of 7 haplotypes should give the following time span to the common ancestor: 1725+/-570 years.

Now I have more markers from the SMGF (Sorenson Molecular Genealogy Foundation). The Iranian haplotypes are concentrated in the Northern Caspian area, Gilaki, Rasht, Astane, Talesh, Rezvanshar, Mazandarani, Tehran, Fars

Gonçalves (Brazilian -SMGF) - 37
Ferrere(Ferreira) 37/33
Abadeh 37/31
Tehran 37/30
Shahroud 37/26

Ferrere(Ferreira) (Portuguese-Reunion-SMGF) - 37
Gonçalves 37/33
Abadeh 37/30
Tehran 37/29
Shahroud 37/26

RCO (Ricardo Costa de Oliveira, Brazilian FTDNA/SMGF) - 28
28/24 Ferrere (Ferreira)
28/22 Gonçalves
28/22 Tehran
28/22 Abadeh
28/20 Shahroud
27/19 Astane

Dominguez – Galicia, Spain, FTDNA/SMGF 28
28/25 Gonçalves
28/25 Ferrere (Ferreira)
28/24 Abadeh
28/23 Tehran
28/22 Shahroud
27/21 Astane
27/19 Rezvanshar

Cordeiro de Melo (Brazilian - SMGF) – 32
25/24 Dominguez
25/20 RCO
32/29 Ferrere (Ferreira)
32/28 Gonçalves
32/26 Tehran

Tehran (SMGF) - 37
37/30 Gonçalves
37/30 Abadeh
37/29 Ferrere (Ferreira)
37/26 Shahroud
36/27 Astane

The Northern Iranian and the Western Iberian clusters are forming a perfect continuum of haplotypes. The Iranian cluster is the older and the most diverse cluster but there’s no distinct DYS maker in the SMGF 37 makers specific to differentiate any of the two distant geographical clusters. I keep the idea that a unique cluster can correspond to a unique historical event linking directly an Iranian speaking population to Western Iberia, the hypothesis of the Alan migration and invasion of Lusitania in 409 AD.

H1 mtDNA 16262T 16278T HVR1 as a genetic signature of the Portuguese maritime expansion

2010-03-02T15:55:00.000-08:00

I have the rare HVR1 16262T 16278T 16519C mtDNA belonging to haplogroup H1

Frequencies of the rare 16262T, 16278T motif in three different databases:

SMGF Brazil 1348/2 (Rio de Janeiro and Santa Catarina)
FTDNA 430/2 Portugal (Brazil and USA with documented genealogies to the Ribeirinha, Terceira, Açores, Azores)
Terceira Island 18/2, Azores (total) 120/2
Mitochondrial DNA patterns in the Macaronesia islands: Variation within and among archipelagos
http://www3.interscience.wiley.com/cgi-bin/fulltext/122687703/sm002.xls?PLACEBO=IE.pdf

In the H1 FGS Project the next close match (without the rare 16262T) is RY9WZ from Valladolid, Spain at the cluster Z1a, but there’s a good distance. So that’s an old Iberian lineage
http://www.familytreedna.com/public/mtDNA_H1/default.aspx?section=mtresults

The 16262T 16278T motif seems to be related to a single woman as a founder colonist in the Terceira Island, Azores. That’s a presumable representative of the first Atlantic embarked European mtDNA in the 15th century and it’s an ethnic and national genetic signature of the old Portuguese Empire. Usually the Portuguese haplotypes are distinctively found clustered only in the Western Iberian Portuguese speaking areas and in the main Colony of Brazil as their big territorial expansion.

The theory of sampling obeys the principle of statistical regularity and the 16262T 16278T mtDNA genetic signature presents specific frequencies and the haplotypes can be analyzed as a more or less regular percentage found in diverse samples from the Azorean and Brazilian populations.

Another European map from deCODEme

2010-02-13T14:35:00.001-08:00

Another European map from deCODEme (thanks to Evon)
Autosomal DNA
The flags are the national clusters
I am the Brazilian flag to the left !

Brazilian cluster/position at deCODEme II

2010-01-11T07:43:00.000-08:00

European local maps.

The first map was made by Evon at DNA Forums. Only two Brazilians there.

The second map is showing the green box of the four Brazilian samples at the same place.

Middle Eastern box with the Brazilian green box outside

European box with the Brazilian green box inside

South West Asian box with the Brazilian green box outside

Brazilian cluster/position at deCODEme

2010-01-11T06:33:00.000-08:00

DECODEME world map.

Circles are individuals. On the top the grey colour representing the European populations. Down to the left, , the Middle Eastern populations (purple) and to the bottom, the African populations(light blue). In the right, the Southwestern Asian populations (brown), the Amerindian populations (red), the Eastern Asian (light green)and the Oceanian populations (dark green ).

Old Colonial Brazilian Stock position at deCODEme

Brazil is one of the most diverse societies of the world.

Brazilians can be everywhere at the deCODEme Map of Kinship.
Some Brazilians are clustering in a specific place.
Ethnic Brazilians of Colonial Portuguese origin are the Brazilians of Old Stock origin, families with a documented and registered history of 500 years in the Brazilian Genealogies from Bahia, Pernambuco, São Paulo and Rio de Janeiro. The old Senhoriato Colonial, “Homens Bons”, old Brazilian Nativism, the Bandeirante stock, the Senhores de Engenho stock, a new original population of European and Portuguese origin that conquered and colonized half of South America, a new amalgama, a new composite made mainly of Northern Portuguese origins with distant small Amerindian and African admixture in the Colonial times and other European admixtures in the last 200 years. In Brazil they are also known as Quinhentões (500 hundreds), “Old Colonial White” Brazilians, European Brazilians of Portuguese Colonial origin. The Y DNA of this group is 100% European and the mtDNA has a representative proportion of European, Amerindian and African mtDNA produced by the Colonial experience in Brazil. In terms of Manhood they represent the main force and the main drive of the Portuguese world wide Empire with a very homogeneous ethnic identity coming from the Minho, Portucale, expressed as a very homogeneous national identity and political unity in Brazil. The old real or imaginary notion of one People, one Language, one Church, One State, One King, One Ethno-National Project of conquest and colonization. In Brazil this group has created a new branch of the Portuguese language, the Brazilian Portuguese and a new branch of the Portuguese State, the Estado do Brasil, State of Brazil organized since 1549.
The Old Brazilian Stock is organized in the European box at deCODEme and they form a new type of population in the World box because they are in the European box closer to the already existent European populations, not being part of any of them and being far more distant to the other world populations listed as references. The Colonial Brazilians can be closer to some European groups than other Europeans are closer to other different European groups. The Old Brazilian Stock position is different from the Portuguese and other Iberian groups. The analyzed Colonial Brazilian proportions at 23andMe and deCODEme are different from the Puerto Ricans in the same way that the Puerto Ricans are very distant from the Mexicans, still we need more data from the American continent. Old Brazilian Stock was a product of 600.000 Portuguese men – Homens - that came to Brazil in the Colonial Era (1500-1808). Nowadays more than 40 millions of Y DNA descend from the founder base. Brazilian diversity has also had Amerindians and imported labourers from Africa, Europe and Asia in the last 500 years and the Old Stock Brazilians have mixed with and assimilated every social group in Brazil in the last 500 years. The Brazilian genetic structure is completely different from the United States and from Mexico, for instance because genetics can only be understood by the sociological analysis of the formation of the Brazilian social classes and the local conflicts. The Old Colonial Brazilians organized the State, the economy, the culture and unleashed several wars against Amerindian groups, European Powers and African Maroons in Brazil to keep the giant territorial size of Brazil and to remain the ruling class and a powerful and rich Brazilian Elite in the last 500 years, always absorbing and incorporating other groups as the Brazilian universal class in the entire Brazilian territory and creating the specific Brazilian melting pot. The important Amerindian and African contributions mixed and structured the Old Brazilian Stock position to the East and to the South of the European box, creating a completely new space present in the European box as a result of the Old Stock Colonial Brazilian references tested there. So history, society, identities and genetics can explain the unique Brazilian autosomal positions at the deCODEme World Map of Kinship.

Brazilian circle, a new world population within the European box

Brazilian green box with four Brazilian samples

European box with the Brazilian green box inside

Ricardo Costa de Oliveira

Diodorus Siculus, Medes to the River Don

2009-12-23T17:37:00.000-08:00

"Greek historian Diodorus Siculus related that the Scythians had carried Medes to the River Don north of the Caucasus presumably from today's northwestern Iran, this event giving rise to their name Sauromatians. Scythians had occupied Media 653-625 B.C.E. Pliny also suggested Sarmatians descended from Medes".
http://en.wikipedia.org/wiki/Haplogroup_G_(Y-DNA)

"The Medes, (Greek Μῆδοι, from an Old Persian Mādai; Middle Persian Māh, Assyrian Mādāyu, modern Med or Medya or مەدئوو مەدیا; New Persian مادها) were an ancient Iranian people [2] who lived in the northwestern portions of present-day Iran. This area is known as Media (also Medea; Greek Μηδία, Old Persian "
http://en.wikipedia.org/wiki/Medes

"It was by these kings that many of the conquered peoples were removed to other homes, and two of these became very great colonies: the one was composed of Assyrians and was removed to the land between Paphlagonia and Pontus, and the other was drawn from Media and planted along the Tanaïs (ancient name for the River Don in Russia), its people receiving the name Sauromatae. 7 Many years later this people became powerful and ravaged a large part of Scythia, and destroying utterly all whom they subdued they turned most of the land into a desert".
Diodorus Siculus Library of History. Book II, 35‑60 (end)
http://penelope.uchicago.edu/Thayer/E/Roman/Texts/Diodorus_Siculus/2B*.html
Pliny, Natural History, VI, ch 7, W. H. Jones, transl., Wm. Heinemann, London, 1949-54

Balance of the year, 2009

2009-12-14T16:09:00.000-08:00

As a balance of the year (2009), I’ve tried to calculate the correlation between my specific haplotype and its overall frequency in terms of the Y DNA structure of the population. I still have absolutely no matches at the FTDNA page, no matches either at the recent ancestral origins page. I only have two J1b 3 -Step Mutations matches at the haplotree matches, one from Portugal and the other from Galicia, Spain. So my haplotype is still extremely rare in the FTDNA database, meaning that it is extremely rare in Western Europe. The two other SNP tested Western Iberian FTDNA J1b haplotypes, one from the Azores, Portugal, and the other from Galicia, Spain are matching each other at 67/64 and I am at a genetic distance of 67/59 from both. As December of 2009 J1b M365 modal haplotype 19-15, 390-22, 393-13, 385a-12, 385b -19or20, 388-16, 458-18.2, YCA21-22

J1b is L136 negative, another proof that some of the most basal clades of J1 are in the Northern areas.

FTDNA (confirmed J1b)
648 Portuguese haplotypes - 2 J1b = 0,3%
Galicia, Spain (close to the Portuguese border) – 1 J1b, no other was found in any FTDNA Hispanic population with several thousands of tested people.

YHRD (presumed J1b – modal haplotype)
Rio de Janeiro – 380 – 1 J1b = 0,2%
Iran – Rasht – Gilaki – 47 – 1 J1b = 2,1 %
Iran – Sari – Mazandarani – 50 – 1 J1b = 2%
Portugal - Azores – 68 – 2 J1b = 2,9%
Turkey (presumed J1b – modal haplotype)
Kahramanmaras – 111 -1 J1b
Kahramanmaras – 109 – 2 J1b (difference from the modal at 390=23)

Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study (2008)Haplotype 389, 1 presumed J1b modal haplotype in 244 Northern Portuguese haplotypes = 0.4%

SMGF (presumed full J1b – modal haplotype)
619 Brazilian haplotypes – 2 J1b = 0,3%
245 Iranian haplotypes –– 5 J1b = 2,0 %, all from Northern Iran and some from the Caspian shores.
2 Reunion Islands, Portuguese origin – 2 J1b – 2/2= 100%

The Portuguese and Brazilian haplotypes are all matching below the limit of 1500 years
The Portuguese/Brazilian and Iranian haplotypes are all matching above the limit of 1500 years

The radar of temporal distances between the SMGF Northern Iranian J1b haplotypes and the Portuguese-Brazilian haplotypes is pointing to approximately 1500 yearsMy own haplotype is matching the Portuguese/Brazilians SMGF haplotypes at 24/28 (Ferrere/Ferreira) and my last (most distant) Brazilian match and my first closest Iranians haplotypes are at 22/28, meaning by SMGF a calculated 50% Cumulative Probability of 48 generations, 1488 yearsThe rate of J1b haplotypes in the Portuguese Y DNA stock is consistent with 0,2 (± 0,2) % in any sample with more than 500/1000 random individuals.The population of the Roman Conventus Bracaraugustanus (more or less the Entre-Douro-e-Minho region) was described by Plinio as 285.000 in 20.300 km², what can be considered the original base of the modern Portuguese and the Brazilian Y DNA stock. The Suevi and Alan migration would had a social, political and demographic impact on that population. A small group or even only one J1b arriving in Northwestern Iberia 1500 years ago, possibly with the Alan migration (40.000 in Iberia, consisting of several different haplotypes and haplogroups of Iranian speaking tribes from the Caucasian, Caspian and Eastern Anatolian area), should be extremely successful to be a regular genetic Y DNA component of the Portuguese stock after 1500 years. One man or a small group in an approximately population of 285.000 (142.500 Y DNA, the initial ratio would be 1/142.500), but the Suevi and Alans arrived as invaders or Conquistadores in Northwestern Iberia, so a possible high social status could mean a kind of reproductive advantage common in that cases. Afterwards the Islamic invasion brought the almost complete destruction of the urban infrastructure because the cities and the main churches were hit hard and only by the 1050-1090 AD a stable frontier was secured by the Northwestern Iberian Christians in the Douro River. So the ethnogenesis and formation of the Portuguese population and the Portuguese language around the year 1000 AD in-between the Entre-Douro-e-Minho area could be perhaps estimated in 200.000 persons, the lowest demographic point after the most destructive incursions of Al-Mansur in the Northern areas of the Iberian Peninsula. Even an already stable J1b haplotype ratio of 0,2% of the estimated 100.000 Y DNA in the Minho around the year 1000 would mean at least 200 men socially well rooted, established and integrated in that population. In times of total war against the Arabs and Moors and later the expulsion or assimilation of the Jews (some specific J1e clusters and clades can be more associated with the Islamic and Jewish religions, like some P-58 can be more associated probably to Arab and Jewish origins), important dividing moments in the history of different J1 clusters from Western Iberia that depending on the religious and political side would had social disadvantages in face of the military destruction and religious prosecution after the ethnogenesis of the Entre-Douro-e-Minho population and the creation of the Portuguese Christian National State with the conquest of the Portuguese territory to the south of Coimbra and the assimilation of an unknown number of local populations (Mozarab, Muladi, Berber, Arab, Jew, Mudejar). Here the traditions and the memories of a genealogical lineage can help. In terms of conventional genealogy the social status of a lineage in the 16th and 17th centuries as “Old Christian” (“Cristão Velho”) and the Honorific Orders and Catholic Priesthood of the Ancien Régime can bring some information about the religious origins of some families in Iberia. Portugal was the first to sail away to discover new lands and the Atlantic expansion was a platform for the big growth of the Portuguese Y DNA in Brazil, meaning the expansion from the old Entre-Douro-e-Minho basal stock where J1b has been part of the vanguards in the new lands and new frontiers. The Roman Empire and the Caliphate politically connected the fringes of Eastern Anatolia and Western Iberia and a Dailamite mercenary or a trader could had traveled between the two points but at 1500 years all the elements are pointing to the known historically registered and documented trip of the Alans. Somehow the old Alan mentality or weltschauung of distant expansion was present in those first journeys of the odyssey of the sea discoveries of the Caravelas and the land discoveries of the Brazilian Bandeirantes, not to mention the idea of a King as a Knight sometimes disappearing in battlefields like some Portuguese Kings did to return encantados.
Let’s wait more results and data !

We need representative databases (different sets of haplotypes with more than 500 collected haplotypes, so we can apply the statistical sampling theory) and we can try to calculate the genetic distances and the different frequencies. The size of a haplotype in a given population can be a historical testimony of old demographic processes. If we don't find matches there must be a historical and social explanation in the same way that a very frequent haplotype in a population also must be explained in terms of social and political hypothesis. Let's read the databases.

J1 Clan Tree Diagram - J1b among the most basal

2009-09-20T03:33:00.000-07:00

J1 Tree Diagram (as designed by the FTDNA J1 Project).

"This diagram of the relationships of 190 J1 haplotypes, from members of this project and of the Arabian J1 project, was created using 52 markers out of the 67-marker set, with 15 of the fastest- mutating markers having been eliminated as unsuitable for phylogenetic purposes. In the future it would be desirable to find a way to incorporate SNP information into the tree creation process. Anyone who can find a way to do this in SplitsTree, please contact the project admin. Clusters are labeled with information known as of 9/6/09".

http://www.familytreedna.com/public/Y-DNA_J/default.aspx?section=results

I am the 73612 haplotype !

Haplotypes are social beings

2009-08-30T07:01:00.000-07:00

Haplotypes are social beings and they are in bands, company of persons, joined, acting, or functioning together; aggregation; party; trooped at regular genetic distances from each other and from other groups.

Genetic Distances (SMGF methodology) of presumed J1b M365 haplotypes
Brazilian/Portuguese-Northern Iranian connection
SMGF Iranian: Tehran, Abadeh, Astane, Shahrood
SMGF Brazilian: Gonçalves, Cordeiro de Melo
SMGF Reunion-Portuguese: Ferrere

Iranian-Tehran presumed J1b haplotype (Y Search FSVWG):
Cordeiro de Melo 26/32 - 50% Cumulative Probability 47 generations – 1457 years
Gonçalves 30/37
Iranian-Abadeh 30/37
Ferrere 29/37
Iranian-Astane 27/36
Iranian-Shahrood 26/37

Iranian-Abadeh presumed J1b haplotype (Y Search XVMBC):
Gonçalves 31/37
Ferrere 30/37
Iranian-Tehran 30/37
Cordeiro de Melo 26/32
Iranian-Astane 28/36
Iranian-Shahrood 29/37

Iranian-Astane presumed J1b haplotype (Y Search 2Y5SH):
Iranian-Shahrood 29/35
Iranian-Abadeh 28/36
Ferrere 27/35
Gonçalves 27/35
Iranian-Tehran 27/36
Cordeiro de Melo 23/30

Iranian-Shahrood presumed J1b haplotype (Y Search 9MS3E):
Iranian-Astane 29/36
Iranian-Abadeh 28/36
Cordeiro de Melo 22/31

FTDNA J1b SNP tested

FTDNA Ricardo Costa de Oliveira Brazil, Barcelos – Portugal (Y Search 2CUZQ):
Dominguez 59/67
Ferrere 24/28
Cordeiro de Melo 20/25
Gonçalves 22/28
Iranian-Tehran 22/28 – 50% Cumulative Probability 48 generations – 1488 years
Iranian-Abadeh 22/28

FTDNA Dominguez – USA, Galicia – Spain (Y Search PRJ9T):
Oliveira FTDNA 59/67
Cordeiro de Melo 24/25
Gonçalves 25/28
Ferrere 25/28
Iranian-Abadeh 24/28
Iranian-Tehran 23/28
Iranian-Shahrood 22/28
Iranian-Astane 21/27

Expected J1b M365 network
Y Search comparisons from Ferrere:
X6P7G Ferrere Reunion Unknown Other – Sorenson

Ferrere to the Western Iberian/Brazilian cluster:

PRJ9T Dominguez Castro, Ourense, Galicia, Spain J1b (tested) Family Tree DNA 32/3
R7SHE Cordeiro de Melo Santana do Livramento, Rio Grande do Sul, Brazil Unknown Other - Sorenson 28/4
2CUZQ Oliveira Sao Romao de Milhazes, Barcelos, Portugal J1b (tested) Family Tree DNA 32/5
6WQMH Gonçalves Imaruí, Santa Catarina, Brazil Unknown Other - Sorenson 32/4

Ferrere to the Northern Iranian cluster:

2Y5SH SMGF Iranian - Astane Astane, Iran Unknown Other - SMGF 28/7
9MS3E SMGF - Iranian - Shahrood Shahrood , Iran Unknown Other - SMGF 32/8
FSVWG Iranian-Tehran -Iran Unknown Other - SMGF 32/9
XVMBC SMGF Iran - Abadeh Fars Unknown Other - SMGF 32/9

Ferrere to the various mini-haplotypes:

CDYQR HP 406 Brazil Unknown Other 15/3
QFBX9 YHRD - Rasht - Gilaki - Iran Iran Unknown Other - YHRD 15/4
38EUZ Haplótipo 389 Portugal Unknown Other 14/2
K3SMV Sardinha Ilha de São Miguel, Azores Unknown Family Tree DNA 12/1
E9YYJ Cuylaerts TURNHOUT, Belgium J1b (tested) Family Tree DNA 12/6
6URZK YHRD possible M365 - Azores/Rio de Janeiro/Turkey Unknown Other - YHRD 9/1
22RY7 YHRD - Caceres - Spain Caceres, Spain Unknown Other - YHRD 9/3
YTHMV Haplótipo 168 Turkey J1b (tested) Other - Cengiz Cinnioglu 9/4

Ricardo Costa de Oliveira

Another map - Alan itinerary in Western Europe

2009-08-23T04:14:00.001-07:00

Iranian, Portuguese, Brazilian SMGF haplotypes

2009-08-22T10:48:00.000-07:00

The Ferrere Family from Reunion is Ferreira, from Lisbon, Portugal. They immigrated to Reunion in the 18th century.

FERRERE, Joachim
Sexe: Masculin Naissance : 11 mars 1726 à Lisbonne, PORTUGAL
Décès : 9 novembre 1787 à St Paul, REUNION, FRANCE
Parents:
Père: FERRERA, Custadio Di
Mère: SANTOS, Domingas Dos

Famille:Mariage: 2 octobre 1747 à St Paul, REUNION, FRANCE

Conjoint:
LAUTRET, Catherine Sexe: Féminin
Naissance : 2 octobre 1722 à St Paul, REUNION, FRANCE
Décès : 26 juin 1786 à St Paul, REUNION, FRANCE
Parents:
Père: LAUTRET, Francois
Mère: TOUCHARD, Marie

http://www.ile-bourbon.net/hoarau/dat7.htm#14

The Alans conquered and settled in parts of Iberia and Lusitania in 409/410. All documented historical sources name the group as Alans.

An original contemporary source, Hydatius Chronicle:

HYDATII EPISCOPI CHRONICON

XV. Alani, et Wandali, et Suevi Hispanias ingressi aera CCCCXLVII, alii quarto kalendas, alii tertio idus Octobris memorant die, tertia feria, Honorio VIII et Theodosio Arcadii filio III consulibus

XVII. Subversis memorata plagarum grassatione Hispaniae provinciis, barbari ad pacem ineundam, Domino miserante conversi, sorte ad inhabitandum sibi provinciarum dividunt regiones. Gallaeciam Wandali occupant et Suevi, sitam in extremitate Oceani maris occidua. Alani Lusitaniam et Carthaginiensem provincias, et Wandali cognomine Silingi Baeticam sortiuntur. Hispani per civitates et castella residui a plagis, barbarorum per provincias dominantium se subjiciunt servituti.

XXII. (Olymp. CCXCIX.) Ataulfus a patricio Constantio pulsatus, ut relicta Narbona Hispanias peteret, per quemdam Gothum apud Barcinonam [Ms. Barcelonam] inter familiares fabulas jugulatur. Cui succedens Wallia in regno, cum patricio Constantio pace mox facta, Alanis et Wandalis Silingis, in Lusitania et Baetica sedentibus adversatur.

http://www.thelatinlibrary.com/hydatiuschronicon.html

Hydatius or Idacius (c. 400— c. 469), bishop of Aquae Flaviae in the Roman province of Gallaecia (almost certainly the modern Chaves, Portugal, in the modern district of Vila Real) was the author of a chronicle of his own times that provides us with our best evidence for the history of Hispania in the 5th century.

http://en.wikipedia.org/wiki/Hydatius

So the Alans in Western Iberia were one specific group of the Northern Iranian speaking languages related to the Sarmatians, Scythians, Massagetae, all related but with specific histories and locations. A very good book that we can read extracts is "Sources on the Alans: a critical compilation" Agustí Alemany.

Claudius Marius Victor wrote in his poem Alethia about the primitive religion of the Alans making of sacrifices to the spirit’s of one’s ancestors and mentions that swords figured prominently in the religion of the ancient Alans as well
"A History of the Alans in the West", Bernard S. Bachrach

More Iranian haplotypes at the SMGF database

2009-08-21T18:21:00.000-07:00

Three more Iranian J1b possible haplotypes at the Sorenson Molecular Genealogy Foundation.

The locations:

Astane, Gilan Province, Northern Iran, close to the Caspian Sea. Y Search - 2X5SH

Shahrood, Semnan Province, Northern Iran, close to the Caspian Sea. Y Search - 9MS3E

Abadeh, Fars with connections with Lahijan, Gilan, also in the North. Y Search - XVMBC

The modal connecting Iranian and Portuguese haplotypes:

The mentioned motif is so rare that absolutely no case was found in the recent paper “Coastal-inland differences in Y chromosomes of the Levant”. Hundreds and hundreds of haplotypes from the Levant and absolutely no J1b modal haplotype was found in that study.

The J1b M365 haplotypes and candidates

http://tinyurl.com/kk4je6

Mexican candidate J1b haplotype

2009-08-09T11:05:00.000-07:00

The first Mexican candidate J1b haplotype

Y Search 49S86 with the distinctive Western Iberian J1b haplotype
DYS 19 = 15
DYS 390 = 22
DYS 393 = 13
DYS 385 = 12,19
DYS 458 = 18 (probably 18,2 - no ,2 was tested in the Mexican batch)

n of N - 1 of 163
Geoposition [Population] - Guadalajara, Mexico [Mestizo]
Metapopulation - Admixed
Continent - Latin America

It`s a completely isolated haplotype, no neighbour or any other match in Mexico, what could mean a possible Colonial Portuguese immigrant or a Colonial Spaniard from Galicia or Extremadura with the Western Iberian or Western Alan J1b motif
No other J1b was ever found in the FTDNA Mexican Project with a good number of tests.

Latest J1 Y chromosome tree as 7/aug/2009

2009-08-09T10:56:00.000-07:00

The J1 Y chromosome tree has been improved and detailed as a result of the FTDNA WTY (Walk Through the Y) Project:

http://www.dna-fingerprint.com/

New FTDNA J M365 Project

2009-07-11T07:04:00.000-07:00

New FTDNA J-M365 Project:
http://www.familytreedna.com/public/m365/default.aspx?section=yresults

New J1 SNP - L136

2009-05-31T17:22:00.000-07:00

L136 ChrY: 7630823 delT is a new SNP in the J1 tree.

It is going to change the known nomenclature, so M365 can be renamed !

http://www.dna-fingerprint.com/images/ytree/J_topology.gif

M365+ J1b is ancestral to L136, so M365 is more basal to the J1 founder than the derived forms of P56 and P58, what can be a hint to the origin of J1 M267. If more L136 - (negative) J1's are found in the North, that's the possible location of the birth of the J1* haplogroup.

Abdalan Clan from Eastern Anatolia

2009-05-27T12:09:00.000-07:00

Someone has noticed me that a member of the Abdalan clan from Eastern Turkey has tested in IGenea as J1b, M365. They are from Erzincan. The Erzincan valley was the location of the most important pre-Christian shrine in Armenia, dedicated to the Iranian goddess Anahit.
I would like to see the haplotype, but it's the first public report of an old Anatolian clan related to J1b M365+
Mere coincidence or a historical register that Abdalan also has had the "Alan" postfix ?

An Estimate of the J1b Age

2009-04-25T18:13:00.000-07:00

An estimate of the J1b cluster’s age according to Professor Anatole Klyosov

Cluster A
001_Portugal 13 22 15 11 12 20 11 16 11 13 11 30
005_Brazil 13 22 16 10 12 19 11 16 11 13 11 29
007_Belgium 13 22 15 10 11 17 11 15 12 13 11 29
009_Azores 13 22 15 10 12 19 11 16 11 13 11 29
010_Spain 13 22 15 10 12 19 11 16 11 13 11 29
012_Brazil 13 22 15 10 12 19 11 16 11 13 11 29
013_Ferrere 13 22 15 10 12 19 11 16 11 13 11 30

The J1b cluster of 7 haplotypes should give the following time span to the common ancestor: 1725+/-570 years.
This standard deviation was calculated here based on a number of mutations and the margin of error for the mutation rate

Now there’s another complete Iranian haplotype from the SMGF database, so we have 8 haplotypes in that J1b cluster A
SMGF – Iran -13-22-15-10-12-20-11-16-11-13-11-29

Cluster B
Qatar 12 -23-14-10-13-19-16-11-13-11-29-17-14-20-11-22-22-15-10-21
Qatar 12- 23-14-10-13-17-16-11-13-11-31-17-14-20-12-22-22-15-10-20
Qatar 12-23-14-11-13-19-16-11-13-11-30-18-14-20-11-22-22-14-10-21

The tree Qatar haplotypes have a common ancestor 2425+/-840 years ago. Such a margin of error is explained by a poor statistics, only three haplotypes.

Yes, it is possible to make an estimate. These two clusters have the following alleles in the 11 markers they both have (A and B, respectively):

13 22 15 10 12 19 X 16 11 13 11 29
12 23 14 10 13 19 X 16 11 13 11 30

Hence, there are 5 mutations between them. This brings their common ancestor to 5700+/-1000 years ago.

New, completely different Qatari J1b cluster

2009-04-20T05:56:00.000-07:00

A Qatari J1b cluster was shown in the new article of Sergio Tofanelli,
"J1-M267 Y lineage marks climate-driven pre-historical human displacements". Supplementary Information. 282 M267* chromosomes from 29 populations typed at 20 YSTRs and 6 SNPs.
http://www.nature.com/ejhg/journal/vaop/ncurrent/suppinfo/ejhg200958s1.html?url=/ejhg/journal/vaop/ncurrent/abs/ejhg200958a.html

Unfortunately they haven't tested the P58 SNP.
Only 3 J1b haplotypes (all in Qatar) were found in this extensive study.

The Qatari J1b cluster is completely different from the previously known J1b STR's.
The genetic distance of the haplotypes among the Qatari J1b cluster is 20/4 and 20/6, what probably means a long established group in that place.
Curiously the Qatari haplotypes are closer to other J1e (P58) and even to some J2 haplotypes than to the already known J1b haplotypes.

If the results are correct J1b M365 is far older and far diverse than I thought and it's impossible to estimate the J1b candidates only analyzing the STR or the haplotypes motifs because the Qatari J1b is completely different from the previously known Eastern Anatolian-Caspian Iranian-Portuguese (Alan ?) J1b cluster original motif.

J1b Qatari haplotypes
http://tinyurl.com/da2vdo

J1b Eastern Anatolian-Caspian Iranian-Portuguese haplotypes and candidates:
http://tinyurl.com/b8tds9

First Iranian J1b strong candidate at the SMGF database

2009-03-17T17:00:00.000-07:00

The fist Iranian J1b strong candidate at the Sorenson Molecular Genealogy Foundation database:

http://www.smgf.org/pages/ydatabase.jspx

DYS 19 = 15

DYS 390 = 22

DYS 393 = 13

DYS 458. 2

DYS 385 = 12-20

YCA 21/22

The SMGF J1b candidate haplotypes:

Brazilian Ancestry Painting

2009-03-07T06:46:00.000-08:00

Ancestry Painting (A.P.) is a new tool of genealogical investigation developed by 23andME

My Ancestry Painting is the product of the Brazilian Genealogy after 500 years of documented lineages, from the Amerindian founders of São Paulo, Rio de Janeiro and Bahia to the bulk of the Portuguese Colonial Elite also admixed with Africans in the Brazilian Ancien Régime following the other mixtures with European Immigrants in the 19th and 20th centuries.

Brazilians with a background in the old Colonial Elite can be considered a New European based Population or a new Portuguese-Western Iberian based population because we don't match exactly with any other European population and we are even more distant from the North African, Middle Eastern, Central Asian, Eastern Asian, African or Siberian populations.

Approximately 60 millions of self-identified "White Brazilians" from a preponderantly Portuguese stock admixed with small proportions of Amerindian (Asian), African and other European genes can be considered the new Brazilian population of Iberian origin. What the Brazilian traditional classic written genealogies knew as the Amerindian forefathers and the most important sociologists like Gilberto Freyre wrote about the African admixture in the Brazilian Slaveholders Masters of the "Casa Grande" can now be genetically determined. That's the Brazilian population that conquered and colonized half of South America and organized the New World biggest flux of Africans across the Atlantic. That's our heritage.

Ricardo Costa de Oliveira A. P.

Location in the general map, I (Ricardo) am the green point in the European Box. Black points are 23andMe customers and friends who shared the results with me.

The Northern European zoom

The Southern European zoom

A study of Eastern European nationalities made in an anthropological forum by Vista

Family Inheritance page

Matching a Grandfather and his Grandson

Mendel family at 23andMe.

Now we can try to find relatives not only in the Y DNA and mtDNA lines.

A new page at Facebook - Chromosomes in Common, searching relatives via genetic genealogy !

http://www.facebook.com/group.php?gid=41094659278

J1 clusters and DYS 385 frequencies

2009-03-06T17:03:00.000-08:00

DYS385 is a multi-copy marker, and includes DYS385a and DYS385b
In terms of the YHRD J1 haplotypes and candidates we can infer that:
DYS 385 13,19 is more frequent in the Semitic and Berber populations
DYS 385 12,18 is more frequent in the Caucasian populations

DYS 385 13,19

19 of 155 Sfax, Tunisia [Tunisian] Afroeurasian - Semitic Africa
18 of 61 Marche, Italy [Tunisian] Afroeurasian - Semitic Europe
14 of 100 Damascus, Syria [Syrian] Afroeurasian - Semitic Asia
13 of 126 Kuwait [Kuwaiti] Afroeurasian - Semitic Asia
10 of 44 Figuig, Morocco [Arab] Afroeurasian - Semitic Africa
9 of 130 Rabat, Morocco [Arabs] Afroeurasian - Semitic Africa
9 of 102 Oran, Algeria [Arab] Afroeurasian - Semitic Africa
8 of 54 Tunis, Tunisia [Tunisian] Afroeurasian - Semitic Africa
6 of 61 Marche, Italy [Moroccan] Afroeurasian - Semitic Europe
6 of 52 Sohag, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa
6 of 52 Qena, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa
5 of 70 Assiut, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa
4 of 113 Syria [Syrian] Afroeurasian - Semitic Asia
4 of 132 Tunisia [Andalusian Arab] Afroeurasian - Semitic Africa
3 of 47 Ahvaz, Iran [Arab] Afroeurasian - Semitic Asia
2 of 102 Adana, Southern Turkey [Eti] Afroeurasian - Semitic Asia
2 of 63 Tripolis, Libyan Arab Jamahiriya [Libyan] Afroeurasian - Semitic Africa
2 of 173 Ethiopia [Amharic] Afroeurasian - Semitic Africa
2 of 83 Egypt [Egyptian] Afroeurasian - Semitic Africa
1 of 23 El Minia, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa

10 of 69 Rabat, Morocco [Berber] Afroeurasian - Berber Africa
5 of 52 Figuig, Morocco [Berber] Afroeurasian - Berber Africa
4 of 109 Belgium [Moroccan Berber] Afroeurasian - Berber Europe

This particular haplotype is found from Egypt to Morocco, a perfect match in 17 markers !
n 19 389i 389ii 390 391 392 393 385 438 439 437 448 456 458 635 ygatah4
15 14 13 30 23 11 11 12 13,19 10 11 14 20 14 18.2 21 11 >>

7 of 61 Marche, Italy [Tunisian] Afroeurasian - Semitic Europe
3 of 61 Marche, Italy [Moroccan] Afroeurasian - Semitic Europe
3 of 102 Oran, Algeria [Arab] Afroeurasian - Semitic Africa
1 of 44 Figuig, Morocco [Arab] Afroeurasian - Semitic Africa
1 of 70 Assiut, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa

DYS 385 12,18 in Caucasian Populations

12 of 26 Dagestan, Russian Federation [Dargin] Eurasian - Caucasian Asia
5 of 22 Dagestan, Russian Federation [Rutuls] Eurasian - Caucasian Asia
1 of 72 Azerbaijan [Azerbaijani] Eurasian - Caucasian Asia

DYS 385 12,18 in Semitic Populations

4 of 126 Kuwait [Kuwaiti] Afroeurasian - Semitic Asia
2 of 83 Egypt [Egyptian] Afroeurasian - Semitic Africa
1 of 132 Tunisia [Andalusian Arab] Afroeurasian - Semitic Africa
1 of 47 Ahvaz, Iran [Arab] Afroeurasian - Semitic Asia
1 of 52 Qena, Upper Egypt [Egyptian] Afroeurasian - Semitic Africa
1 of 173 Ethiopia [Amharic] Afroeurasian - Semitic Africa
1 of 128 Sanaa, Yemen [Yemeni] Afroeurasian - Semitic Asia
1 of 100 Damascus, Syria [Syrian] Afroeurasian - Semitic Asia
1 of 54 Tunis, Tunisia [Tunisian] Afroeurasian - Semitic Africa
1 of 102 Oran, Algeria [Arab] Afroeurasian - Semitic Africa
1 of 63 Tripolis, Libyan Arab Jamahiriya [Libyan] Afroeurasian - Semitic Africa

DYS 385 13,19 Caucasian Populations

1 14 13 29 23 10 11 12 13,19 -1 -1 -1 -1 -1 -1 -1 -1 >>
1 14 14 32 23 10 11 12 13,19 -1 -1 -1 -1 -1 -1 -1 -1 >>
1 15 14 28 23 10 10 14 13,19 -1 -1 -1 -1 -1 -1 -1 -1 >>
1 15 14 29 23 10 10 14 13,19 -1 -1 -1 -1 -1 -1 -1 -1 >>
1 16 12 28 24 10 11 13 13,19 -1 -1 -1 -1 -1 -1 -1 -1 >>

1 of 22 Dagestan, Russian Federation [Rutuls] Eurasian - Caucasian Asia
1 of 100 Armenia [Armenian] Eurasian - Caucasian Asia
1 of 77 Georgia [Georgian] Eurasian - Caucasian Asia
1 of 26 Dagestan, Russian Federation [Dargin] Eurasian - Caucasian Asia
1 of 72 Azerbaijan [Azerbaijani] Eurasian - Caucasian Asia

DYS 385 13,15 in J1e “Cohanin”

DYS 385 12,19 and 12,20 are proportionally more frequent among the Western Iberian J1b M365+ haplotypes than in any other cluster.

J1b Cluster Family, M365+ haplotypes and candidates:
http://tinyurl.com/b8tds9

Moors and Saracens in Europe

2009-03-06T16:47:00.000-08:00

Moors and Saracens in Europe: estimating the medieval North African male legacy in southern
Europe
Cristian Capelli et al: 2009
European Journal of Human Genetics (2009), 1 – 5

Table 1 Historically introduced NW African types in Italy and Iberia
Sample n E1b1b1b E1b1b1a J1 Total %
1 Val Badia 34 0.0 0.0 0.0 0.0
2 Veneto 55 1.8 0.0 0.0 1.8
3 Central Emilia 62 0.0 0.0 0.0 0.0
4 Central-Tuscany 41 0.0 0.0 2.4 2.4
5 Tuscany-Latium border 79 0.0 0.0 0.0 0.0
6 North-East Latium 55 1.8 0.0 0.0 1.8
7 Marche 221 0.0 0.5 0.9 1.4
8 South Latium 51 0.0 0.0 0.0 0.0
9 East Campania 84 2.4 1.2 1.2 4.8
10 North-West Apulia 46 4.3 0.0 2.2 6.5
11 Lucera 60 1.7 1.7 0.0 3.3
12 West Calabria 56 0.0 0.0 0.0 0.0
13 South Apulia 71 0.0 0.0 1.4 1.4
Peninsular Italy 915 0.8 0.3 0.7 1.7
14 Sicily 93 2.2 2.2 3.2 7.5
15 Portugal 659 5.0 0.3 1.8 7.1
16 Galicia 292 4.1 0.7 2.1 6.8
17 Cantabria 161 13.0 3.1 2.5 18.6
18 Basques(d) 168 0.6 0.0 0.6 1.2
19 Basques(e) 43 2.3 0.0 0.0 2.3
20 Catalanse 16 0.0 0.0 0.0 0.0
21 Andalusianse 37 5.4 0.0 0.0 5.4
Total Spain 717 5.2 1.0 1.5 7.7
Total Iberia 1376 5.1 0.7 1.7 7.4

J1b M365 is definitely negative (ancestral) to P58.

2009-02-28T19:04:00.000-08:00

I received my 23andMe results. Very interesting !
P58 (J1e) rs34043621 can point to an interesting position in the J1 haplogroup.
In general terms P58, J1e, was an historical edge on the J1 history and J1e P58+ is far more associated to the Semitic groups. J1 with the negative P58 is absolutely not related to the Semitic populations. Probably J1 was born around the Taurus-Zagros line and the oldest and most diversified J1 haplotypes are located in the Anatolian and Caucasian areas, where some of the highest frequencies of J1 in the world are found in places like Daghestan. J1e and the modals found in the Jewish and Arab populations to the South are considerably younger and less diversified.
I am P58- (negative, ancestral, with the TT) what points to the ancient Northern variants of J1 in the J1b clade, just like the known J1 DYS 388=13 cluster.
I am TT positive to L60 rs2008924, definitely another J SNP

A new methodology of estimating ancient or medieval "Invaders" Y DNA in Europe

2009-02-15T05:26:00.000-08:00

The recent article “Moors and Saracens in Europe: estimating the medieval North African male legacy in southern Europe” (Capelli et al - European Journal of Human Genetics (2009), 1 – 5) proposes a methodology: “So, considering 9 loci and 40 generations (approximately 1200 years ago with a 31-year generation length14), either 0 or 1 mutational difference is the most likely consequence. Two mutations are only slightly less likely, but overlap with other much more ancient events, for example 80 generations or 2400 years ago. Posterior distributions for more ancient events have probability peaks centred on a higher number of differences, with 0–1 mutations being extremely unlikely (data not shown). Therefore, following this, European Y chromosomes within the three haplogroups identical to, or with one mutational difference from, NW African STR haplotypes were considered compatible with an MNA (medieval Northern African) ancestry. In Iberia and peninsular Italy, they account for 90, 78 and 42% of the E1b1b1b, E1b1b1a-b and J1 chromosomes respectively”.
(9 STR loci - DYS19, DYS389 I–II, DYS390, DYS391, DYS392, DSY393, and the bi-allelic DYS385)

Historically introduced NW African types in Italy and Iberia
Frequencies of E1b1b1b chromosomes with 0-1-steps neighbour chromosome within the NW African dataset.
The database included 127 Berbers from Tunisia; 102 South Tunisians; 109 Moroccan Arab and Berber speakers; 50 Moroccan and 52 Tunisians (unpublished data)

Region – n - %
1 Val Badia 34 - 0.0
2 Veneto 55 - 1.8
3 Central Emilia 62 - 0.0
4 Central-Tuscany 41 - 0.0
5 Tuscany-Latium border 79 - 0.0
6 North-East Latium 55 - 1.8 .
7 Marche 221 - 0.0
8 South Latium 51 - 0.0
9 East Campania 84 - 2.4
10 North-West Apulia 46 - 4.3
11 Lucera 60 - 1.7
12 West Calabria 56 - 0.0
13 South Apulia 71 - 0.0
Peninsular Italy 915 - 0.8
14 Sicily 93 - 2.2
15 Portugal 659 - 5.0
16 Galicia 292 - 4.1
17 Cantabria 161 - 13.0
18 Basques 168 - 0.6
19 Basques 43 - 2.3
20 Catalans 16 - 0.0
21 Andalusians 37 - 5.4
Total Spain 717 - 5.2
Total Iberia 1376 - 5.1

Data not shown in the article but we can use YHRD.
In the case of E1b1b1b M 81+
13-14-30-24-9-11-13-13,14
285 matching haplotypes !

36 of 109
Belgium [Moroccan Berber]
19 of 31
Zriba, Tunisia [Tunisian]
17 of 1177
Antioquia, Colombia [Mestizo]
15 of 792
Central Portugal [Portuguese]
11 of 130
Rabat, Morocco [Arabs]
11 of 102
Oran, Algeria [Arab]
11 of 1237
United States [Hispanic American]
10 of 387
Andalucía/Extremadura, Spain [Spanish]
9 of 654
Buenos Aires, Argentina [European]
9 of 132
Tunisia [Andalusian Arab]
6 of 566
Northern Portugal [Portuguese]
5 of 152
New York City, United States [Hispanic American]
4 of 32
Pennsylvania, United States [Hispanic American]
4 of 255
Rio Grande Do Sul, Brazil [European]
4 of 69
Rabat, Morocco [Berber]
4 of 447
Sao Paulo, Brazil [European]
4 of 155
Sfax, Tunisia [Tunisian]
4 of 152
Madrid, Spain [Spanish]
4 of 53
Connecticut, United States [Hispanic American]
4 of 245
Rio de Janeiro, Brazil [European]
4 of 101
Cantabria, Spain [Spanish]
4 of 311
Peru [Mestizo]
3 of 63
Tripolis, Libyan Arab Jamahiriya [Libyan]
3 of 135
Rio de Janeiro, Brazil [African]
3 of 30
Tunisia [Berber]
3 of 61
Marche, Italy [Moroccan]
3 of 365
Mendoza, Argentina [European]
2 of 212
Costa Rica [Mestizo]
2 of 201
Somalia [Somali]
2 of 52
Sohag, Upper Egypt [Egyptian]
2 of 52
Figuig, Morocco [Berber]
2 of 103
Santiago de Compostela, Spain [Spanish]
2 of 74
Texas, United States [Hispanic American]
2 of 314
Sicily, Italy [Italian]
2 of 46
Virginia, United States [Hispanic American]
2 of 95
Nariño, Colombia [Mestizo]
2 of 91
Cauca, Colombia [Mestizo]
2 of 68
Azores, Portugal [Portuguese]
2 of 68
Illinois, United States [Hispanic American]
2 of 224
Barcelona, Spain [Spanish]
2 of 61
Marche, Italy [Tunisian]
2 of 123
Nicaragua [Mestizo]
2 of 224
Rio Negro, Argentina [European]
1 of 46
Zeeland, Netherlands [Dutch]
1 of 113
Belgium [Flemish]
1 of 125
Lyon, France [French]
1 of 120
Zaragoza, Spain [Spanish]
1 of 52
Qena, Upper Egypt [Egyptian]
1 of 91
Majorca, Spain [Spanish]
1 of 62
Caracas, Venezuela [Mestizo]
1 of 324
Chihuahua, Mexico [Mestizo]
1 of 147
Bogotá, Colombia [Mestizo]
1 of 108
Chubut, Argentina [European]
1 of 70
Assiut, Upper Egypt [Egyptian]
1 of 108
Cape Town, South Africa [European Afrikaner]
1 of 34
Cundinamarca, Colombia [Mestizo]
1 of 112
Southern Portugal [Portuguese]
1 of 20
Sciacca, Italy [Italian]
1 of 90
Asturias, Spain [Spanish]
1 of 384
Ravenna, Italy [Italian]
1 of 71
Atlántico, Colombia [Mestizo]
1 of 40
Sao Paulo State, Brazil [African]
1 of 46
Porto Alegre, Brazil [European]
1 of 433
Freiburg, Germany [German]
1 of 1276
United States [African American]
1 of 66
Sao Paulo State, Brazil [European]
1 of 53
Olomouc, Czech Republic [Czech]
1 of 99
Strasbourg, France [French]
1 of 54
Tunis, Tunisia [Tunisian]
1 of 199
Valencia, Spain [Spanish]
1 of 23
Florida, United States [Hispanic American]
1 of 909
Finland [Finnish]
1 of 120
Quito, Ecuador [Mestizo]
1 of 168
Northern Spain [Basque]
1 of 98
Madeira, Portugal [Portuguese]
1 of 42
Oregon, United States [Hispanic American]
1 of 29
Ragusa, Italy [Italian]
1 of 281
Munich, Germany [German]
1 of 243
Rostock, Germany [German]
1 of 134
Pyrenees, Spain [Spanish]
1 of 215
Novi Sad, Serbia [Serbian]
1 of 134
Choco, Colombia [African]

The same methodology can be applied to the YHRD results for the “J1b modal haplotype candidates”, the presumed “Western Alan Modal haplotype”
(9 STR loci - DYS19, DYS389 I–II, DYS390, DYS391, DYS392, DSY393, and the bi-allelic DYS385)

15-13-29-22-10-11-13-12,20
1 of 47 Rasht, Iran, [Gilaki] Eurasian - Indo-Iranian - Asia

Differences with 0-1 mutation in this extremely rare haplotype, one of the smallest clades found in Europe:

15-13-29-22-10-11-13-12,19
2 of 68 Azores, Portugal [Portuguese] Eurasian - European - Western European - European
1 of 135 Rio de Janeiro, Brazil [African] African, Afro-American – Latin America
1 of 111 Turkey, Kahramanmaras, Southern Turkey [Romani] Eurasian - Indo Iranian – Asia

15-13-29-22-10-11-12-12,20
1 of 91 Caceres, Spain [Spanish] Eurasian – European – Western European – Europe
A new haplotype found in the YHRD database. Caceres is very close to the Portuguese border and was part of the old Roman Lusitania. (Catálogo Monumental de Caceres - “ocupada por Alanos”).

We can even imagine that the Alans ride from the Caucasus to Lusitania, as an ethos or an attitude, would be resumed after some centuries and would go on over the Atlantic and would continue in the Brazilian wilderness with the Bandeirantes, century by century !
Invaders in Europe, Invaders in America
Entre Conquistadores !

Y DNA haplotypes and frequencies. The Portuguese-Brazilian J1b case

2008-12-07T13:06:00.000-08:00

How can we find if a haplotype is considered as “established” or “outsider” in a given population?
It’s a question of frequency, perhaps. If a haplotype with a recognized genetic motif is present in any reliable sample of the population then we can infer that the haplotype is well distributed homogeneously in the population in a certain frequency. Even small frequencies of the order of 0,1 % can be detected and recognized in the case of big samples (<500). My case study is the frequency of the rare, but clearly visible J1b M365+ haplotypes in the Brazilian and Portuguese population. This genetic signature can be easily identified with the DYS19=15, DYS=390=22, DYS393=13 and a J1 signal like 458.2 or 388=16 what is a most probable way to capture a J1b haplotype.
In every big Portuguese and Brazilian databases (FTDNA, YHRD, SMGF) I can find the mentioned J1b motif provisory named as the “J1b Alan Modal Haplotype” in the Portuguese and Brazilian DNA stock. The frequency of the Portuguese J1b STR/SNP in the Portuguese population is estimated in between 0,2-0,8% of the total. The Portuguese Y DNA contribution to the Brazilian population has been estimated in circa de 40% (Sérgio Pena: 2000) what means 5 millions of Portuguese Y DNA in Portugal and 40 millions in Brazil. A haplotype will be considered as an established haplotype in a population if it’s found in a regular frequency in a constant and homogeneous participation in any big sample of this population. That’s the case of the J1b haplotype.
The article “Haplotype diversity of 17 Y-chromosome STRs in Brazilians”, Pereira et al, Forensic Science International 171 (2007) 226–236, lists 481 Brazilian haplotypes and there’s one identified as J1b, the number HP 406 with the “Alan Modal Haplotype”: DYS19=15, DYS=390=22, DYS393=13, the 458.2 and the rare DYS385I/II 12-20. So, just like the FTDNA, YHRD, SMGF databases, this article also keeps the regular statistical frequency of 0,2% of the Brazilian J1b haplotype.
The J1b haplotype participation in the Brazilian and Portuguese population must be related to its participation since the formation of the original stock of the Portuguese population during the “ethnogenesis age” of the creation of this distinct population organized around the Minho and Douro rivers 1500 years ago (Hispano-Romans, Suebis, Alans coalescence in the Minho-Coimbra area). That’s the same chronology of the formation of the Portuguese language as a distinct and organized language. The consequence of a distinct community organized as a distinct society with a specific language led to the creation of hierarchies, social stratifications and finally led to the creation of the independent Portuguese National State around the 12th century as a response to the Moor Almoravid and Almohad onslaught of the 11th century. In the last thousand years the Portuguese population had gone through two bottlenecks, one around the year 1000 AD with the Moor pressure and the other in the Thirty Years War (1630-1654) with the Castilian pressure in Iberia and the Dutch pressure in Brazil, in both cases the threats of annihilation of the autonomy and existence of this population in Europe and in America led to a situation of total war and a subsequent victory with a new demographic boom of the Portuguese-Brazilian population in new conquered territories. The original male population of the Entre Douro e Minho with a population of perhaps 30.000 Y DNA around the year 1000 AD has multiplied to a half a million in 1500 and to 45 millions nowadays. The Minho little population with few resources has been able to conquer Portugal and then conquer one of the world big territories in Brazil to become one of the world’s “Monster Country”. So the calculated total number of J1b’s haplotypes in the Portuguese-Brazilian population (from 0,2 to 0,8%) of the total population (45 millions) could be between 90.000 and 360.000. A single male, the J1b Western Iberian Genearch perhaps coming in the Alan invasion, was the founder of this lineage. Would it be possible to guess any kind of social status of his position after a thousand of years ? That’s a difficult question but somehow this Eastern Anatolian/Caucasian/Caspian “exotic” Y DNA could survive and thrive in a completely different place in the westernmost part of Western Europe, in times of war and destruction, in a very distant population very far way from the place of the original source and original habitat of this SNP and in a completely different hostile haplogroup environment. What I can say is that most probably this haplotype had entered the Portuguese stock before or just at the exact foundational moment of the ethnogenesis of the Portuguese population because it’s well rooted in some deep rural traditional places of the Minho and it is very well homogeneously distributed with a regular frequency in every big sample of the Portuguese and Brazilian population. The J1b haplotype was not observed in the recent article “The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula”. No Hispanic populations of Castilian, Catalan, Basque languages of Iberia and no Sephardic, Jew, Moor, Arab or North African population has presented this haplotype. The J1b M365+ is a Western Iberian-Portuguese-Brazilian phenomenon.

The American Journal of Human Genetics 04 December 2008
doi:10.1016/j.ajhg.2008.11.007
The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
Supplemental Data for M. Adams et al.

http://www.cell.com/AJHG/supplemental/S0002-9297(08)00592-2

Haplotype diversity of 17 Y-chromosome STRs in Brazilians .
Forensic Science International , Volume 171 , Issue 2 - 3 , Pages 226 - 236
R . Pereira , E . Monteiro , G . Hirschfeld , A . Wang , D . Grattapaglia

List of J1b haplotypes and candidates with the new Brazilian HP406 haplotype:

http://tinyurl.com/5bg4f4

Ricardo Costa de Oliveira

Legends of the nomadic Iranian speaking tribes in Eurasia

2008-12-07T12:55:00.000-08:00

- England and Japan

C. Scott Littleton, Occidental College, Los Angeles
Yarnato-takeru: An "Arthurian" Hero in Japanese Tradition

"The curious similarities between the legendary Japanese hero Yamato-takeru and King Arthur do not appear to be merely fortuitous. We now know that between the second and the fifth centuries A.D. the folklore of both Japan and Western Europe was influenced-both directly and indirectly - by that of several nomadic Northeast Iranian speaking tribes (Sarmatians, Alans, etc.). These tribes originated in the steppes of what is today southern Russia and the Ukraine. The last surviving Northeast Iranian speakers,the Ossetians of the north-central Caucasus, preserve a corpus of legends about a hero called Batraz who closely resembles both Yamato-takeru and Arthur. It is suggested that Yamato-takeru, Arthur, and Batraz derive from a common Northeast Iranian prototype".

Asian Folklore Studies, Volume 54, 1995: 259-274
http://www.nanzan-u.ac.jp/SHUBUNKEN/publications/afs/pdf/a1074.pdf

-Portugal

Manuscript of Fray Bernardo de Braga (?-1605) “Sobre a precedência do reino de Portugal, ao reino de Nápoles”
http://tinyurl.com/64lpt2
The first king of Lusitania was Respendial (Rapantiano, Rapantianus) and the second was Ataces (Atacces, Adax) Lusitania rex. One of the first kings in Western Europe after the Roman Empire, the idea of a warrior king as an Eastern Iranian cultural import in the Western Atlantic façade ?
« Rapantianus Lusitaniam a Romanis capessit , fuit « Alanus quidem et Lusitania rex, sed breviter a suis « occisus successit Atacius, qui ultra Lusitaniam « suum Regnum dilatavit,... «
“Resplamdiano Alanorun Regi defuncto successit Atax”.
Coimbra was the capital of the Alan Kingdom of Lusitania and the King Ataces was killed in battle against the Visigoths. 1156 years later another Portuguese King, successor of the Alan Kings from Lusitania, was killed again in battle, Dom Sebastião killed in action in Alcacer Quibir, 4 of august of 1578, in North Africa. D. Sebastião took the sword of Afonso Henriques, the first Portuguese King from the Santa Cruz Monastery, in Coimbra.

The kings as warrior knights, the symbolic swords and the messianic figure of the lost kings are common elements.
In some cases DNA and legends can travel together and they can make difference far away from the point of origin. Kings had knights and troops with them, perhaps some remnant elements of this DNA “gesta” can be found nowadays in some parts of Eurasia. Rare Exotic Y DNA matching haplotypes in the Caucasus, Iran and in Portugal can be very good candidates for this kind of gesta in the Portuguese case.

Alan Influence in Western Iberia

2008-11-23T02:40:00.000-08:00

"The continued existence of several Alan place names in Spain also suggests that Alan influence was not completely erased by Visigothic domination. As late as 575 Orense, a part of Galicia where the Alans are known to have flourished with imperial support until about 428-429, was controlled by a senior loci with the very Alan-sound name of Aspidius. The asp- element derives from the Iranian word from horse as exemplified in the name of the famous East Roman Alan general Aspar. Aspidius may have been a Latinized form of the Iranian name or perhaps of the name as they appear in the Greek form"Bachrach: 1973, 98
A History of the Alans in the West: From Their First Appearance in the Sources of Classical Antiquity Through the Early Middle Ages. Bernard S. Bachrach. U of Minnesota Press, 1973ISBN 0816606781, 978081660678.8

http://books.google.com.br/books?id=SXER_fLym9kC&pg=PA98&dq=Aspidius&lr=#PPA98,M1

Manuel Alberro supports this idea in his article “Los Alanos in Gallaecia …” (Gallaecia, Year 2004, N° 23, 301-329). (John Biclar, Chron.,s,a. 575, Thompson 1962:62)
http://dialnet.unirioja.es/servlet/articulo?codigo=963590

Isn’t it a coincidence that the only J1b M365+ found in Galicia, the only one found in NW Spain is located exactly in… Ourense (or Orense) ! (FTDNA, 82640)
http://www.familytreedna.com/public/Y-DNA_J/index.aspx?fixed_columns=on

In the Cambridge Medieval History, Volume II, 1913 Aspidius is even quoted as “King”.“that mountainous district known as Aregenses, situated in what is now the province of Orense, and of which a certain Aspidius was king” A group of Alans settled in Northern Gaul. Sources on the Alans: A Critical Compilation. Agustí Alemany. BRILL, 2000. Could be the distant origin of the Belgium case of J1b M365+ ?
And the bulk of the Iberian Alans settled in Lusitania under the command of Respendial and Attaces, “Lusitania Rex” and could be the explanation of the Portuguese J1b M365+ cases around the world. Given the distribution of the Portuguese J1b haplotypes, that could be perhaps an indication of an Iranian speaking Alan genetic signature associated or not to some cases of alpha males or just fellow travellers in Western Iberia ? The first idea of a Kingdom in Western Iberia (even in Western Europe after the Roman Empire) would be an invention of the Alans. BERNARDO de Braga, O.S.B. ?-1605, Tratado sobre a precedencia do Reino de Portugal ao Reino de Napoles.
http://books.google.com.br/books?id=9bYRAAAAYAAJ&pg=RA2-

A haplotype with absolutely no Y DNA matches and absolutely no recent ancestral origins listed at the FTDNA database (any other case has been found xJ1b?) can be considered rare and unique and it's the obvious result of a rare and unique event because in the last 4000 years almost all clusters and haplotypes have experienced a kind of star like growth distributed over contiguous territories with different frequencies. When I see that there are some haplotypes with hundreds or even thousands of matches at the databases I realize that my haplotype is unique and rare and most probably it's associated to a unique and rare event that was the opening of a passage (a dimensional portal) between Eastern Anatolia/the Caucasus/the Caspian Sea and Western Iberia in another extreme of Europe. All other J haplotypes and clades are more or less evenly distributed in a contiguous area with a regular gradient of genetic distances. A haplotype generally has a continuum matching of haplotypes in terms of genetic distances in a territorial continuum of frequencies. If you can't find matches and there's not a territorial continuity then the haplotype must be associated to a rare and unique event that caused its existence in completely different and distant small hot spots. The Central Arena of Eurasia is the circle between Anatolia-Armenia-Caucasus and the Northern Levant, that's a tough space to survive and prevail and no Y DNA haplogroup or language could be hegemonic there for a long time. Probably the only possible dimensional gate that linked Western Iberia with this Central Arena was the rare and unique event of the Hunnic invasions and the Fall of the Western Roman Empire, when a fierce group could cross the entire continent of Europe from one edge to another. If my calculus is correct J1b shall be found in small rural and remotes places in Western Iberia and in the Brazilian demographic boom of the last centuries where finally J1b has found a big new world full of space.

Alan Light Cavalry in an imaginary representation
Pro Deo et Rege

So It seems that J1b M365+ does not like the Mediterranean Sea

2008-11-23T01:24:00.000-08:00

No J1b M365 known haplotype (DYS393=13, DYS390=22, DYS19=15) has ever been found in the Mediterranean populations databases. Not only in the FTDNA Projects, including the J Project, neither in several scientific articles with supplemental data.

That's also a case of negative validation, No J1b haplotype was found in these articles:

- Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean. Pierre A. Zalloua et al (2008)
http://www.cell.com/AJHG/fulltext/S0002-9297(08)00547-8
- Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample. C. Robino et al (2008)
- Y-chromosomal STR haplotypes in Berber and Arabic-speaking populations from Morocco. Forensic Sci Int. 140:113–115. Quintana-Murci L, Bigham A, Rouba H, Barakat A, McElreavey
K, Hammer M (2004)
- The Y chromosome pool of Jews as part of the genetic landscape of the Middle East. Am J Hum Genet 69:1095–1112. Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M,
Oppenheim A (2001)

Animals as Fellow Travellers

2008-10-04T07:05:00.000-07:00

'Viking mouse' invasion tracked, BBC noticed this week
http://news.bbc.co.uk/2/hi/science/nature/7645908.stm
"What this suggests to us is that the Norwegian Vikings were taking these mice around and they were taking a particular genetic type; because there are all sorts of genetic types and the particular type that happened to be where the first Vikings picked them up is the one that got spread around."

Geneticists could also track the supposed "Alan's dog"

The Spanish Alano today is a legacy of the Alan tribe which entered the Iberian Peninsula with the Vandal hordes during the early part of the 5th Century. The Alani were one of the Sarmatian peoples which inhabited the plains along the River Don to the northeast of the Sea of Azov in modern-day Russia. Formidable horsemen and skilled bowmen, these warring nomads were also famous for their dogs

http://en.wikipedia.org/wiki/Alano_Espa%C3%B1ol

Molosser

http://en.wikipedia.org/wiki/Molosser

Alaunt

http://en.wikipedia.org/wiki/Alaunt

"Paul Strang, a cynologist and a noted authority on the Great Pyrenees, observes in his book "The Complete Great Pyrenees", that the existence of massive native breeds today in Turkey, Iran, and Southern Russia could support the theory that the ancestors of today's mastiff breeds came from the Middle East. Other serious cynologists, such as David and Judy Nelson, agree with that possibility. Remains of domestic dogs from 5500 years ago have discovered in many parts of Iran of today. But the territory of Iran of today is not the same lands of old Persia which was much bigger and included the lands from India in east to Greece in west. Even the areas of southern Russia and the central Asia of today (Caucas, Azerbaijan, Armenia, Georgia and...) or better to say the origin area of Mid. Asian and Caucasian shepherds were the Iranian territories and passed to Russia after peace between the two countries, just about 100 years ago. These areas were the "lands of mastiffs" for thousands of years. Four kinds of old Persian dogs were reported by the classical authors" (Source: Persian Mastiffs a brief historical summary about the ancient mastiffs of Iran)

http://irandogs.110mb.com/breeds/mastiff/mastif.html

Hyrcanian Mastiff, "Lion dog"

Brazilian Fila (Fila Brasileiro), also known as Brazilian Mastyff

The Fila Brasileiro is believed to have been developed from a number of breeds, predominantly the Mastiff, the Bulldog and the Bloodhound (the last contributing to breed's loose skin). The Fila Brasileiros were found primarily on large plantations and cattle farms from where they originated. Reportedly, they are also excellent tracking dogs and were used to track slaves and fugitives

http://en.wikipedia.org/wiki/Fila_Brasileiro

Hyrcania, New-Found Connection

2008-10-04T04:17:00.000-07:00

October's YHRD new release of haplotypes revealed samples of DNA from the Southern Caspian Sea peoples, a region known in ancient times as Hyrcania, the ancient state in the north of Iran . The southern shores of the Caspian Sea (Hyrcanian Sea) are the Iranian provinces of Gilan and Mazandaran.

Wiki

The J1b M365+ "genetic signature" (the distinct DYS 393=13, 390=22, 19=15 and the J1 indicator 458=18,2) has been found there:

1/47 (one in 47 tested) - Rasht, Gilaki, Iran
1/50 (one in 50 tested)- Sari, Mazandarani, Iran

19 – 389I – 389II – 390 – 391 – 392 – 393 – 385 – 438 – 439 – 437 – 448 - -456 – 458 – 635– GATA H4:
15 – 13 – 29 – 22 – 10 – 11 – 13 – 12,20 – 10 – 11 – 14 – 20 – 15 – 18,2 – 21 -10 Rasht, Gilaki, Iran
15 – 13 – 29 – 22 – 10 – 11 – 13 – 12,12 – 10 – 11 – 14 – 20 – 15 – 18,2 – 20 -10 Sari, Mazandarani, Iran

I keep the Alan’s hypothesis as the source of J1b presence in Portugal and in Brazil, the Alans were an Iranian nomadic group !

The Alans have been in Hyrcania, according to Josephus:

Now there was a nation of the Alans, which we have formerly mentioned some where as being Scythians and inhabiting at the lake Meotis. This nation about this time laid a design of falling upon Media, and the parts beyond it, in order to plunder them; with which intention they treated with the king of Hyrcania; for he was master of that passage which king Alexander [the Great] shut up with iron gates. This king gave them leave to come through them; so they came in great multitudes, and fell upon the Medes unexpectedly, and plundered their country, which they found full of people, and replenished with abundance of cattle, while nobody durst make any resistance against them; for Paeorus, the king of the country, had fled away for fear into places where they could not easily come at him, and had yielded up every thing he had to them, and had only saved his wife and his concubines from them, and that with difficulty also, after they had been made captives, by giving them a hundred talents for their ransom. These Alans therefore plundered the country without opposition, and with great ease, and proceeded as far as Armenia, laying all waste before them

http://www.sacred-texts.com/jud/josephus/war-7.htm

What is remarkable is that apparently J1b M365+ can be found only in regions impacted and crossed by the Alans. The genetic distance of all haplotypes is relatively tightly closed from Hyrcania to old Roman Gallaecia in Northwestern Iberia, almost the same haplotype covering big geographical distances and centuries of separation from the common tribal source, but showing little genetic distance revealing a recognizable distinct homogeneous pattern with minimal differences in spite of the space and ages trekked.

Up-to-dated Haplotypes:

http://tinyurl.com/3qwytu

Up-to-dated J1b Map

http://tinyurl.com/5owkuh

Crossroads, Eastern Anatolia, J1b M365 Land

2008-08-24T03:50:00.000-07:00

Eastern Anatolia is the place where J1b M365 was first reported and probably is the historical core of this genetic genealogical marker.

Anatolia history is full of civilizations since the advent of the neolithic and the creation of the first states in the region. J1b M365 has seen historical actions in the following events that took part in Eastern Anatolia:

1 -The Roman frontline against the Alans in 135 AD, as described by Arrianus:

Source:

http://members.tripod.com/~S_van_Dorst/Ancient_Warfare/Rome/Sources/ektaxis.html

http://www.satrapa1.com/articulos/antiguedad/Alanos/arriano_alanos.htm

2 - Urartu, the mysterious Kingdom

Source:

http://www.satrapa1.com/articulos/antiguedad/oriente/atlasoriente.htm

3 - The even more mysterious Cimmerians

Source:

http://en.wikipedia.org/wiki/Cimmerians

If only DNA could speak !

2008-08-23T03:33:00.000-07:00

Artistic representation of the "Crossing of the Rhine", a mixed band of Vandals, Alans and Suebi crossed the frozen Rhine at Mainz on December 31, 406, and began to ravage Gaul and Iberia.

Suebi flag as described by Fray Bernardo de Braga and Fray Bernardo de Brito

Ossetian coat of arms

Coimbra coat of arms

Red Lion of Alan origin

2008-08-18T14:45:00.000-07:00

Interpretations

How could J1b arrive to Western Iberia ?
In terms of geographical curiosity J1b M365 linked Eastern and Western Iberia !

J1 M267 in Western Iberia could be related to several Eastern migrations or invasions since Prehistory. Iberomaurusian groups coming before the Neolithic, groups coming with the Neolithization of the Peninsula, groups arriving with early seafarers from Phoenicia or from Greece, Jews or Arabs could have brought some of the J1 M267 to Western Iberia. Every hypothesis is possible and must be tested.

The only organized migratory wave of people to Lusitania and Western Iberia coming from Eastern Anatolia and the Caucasus is the Alan movement in the fall of the Roman Empire.

One of the best compilations about the Alans is the book "Sources on the Alans" written by Agustí Alemany. Hydatius bishop of Aquae Flaviae (modern Chaves) wrote that in 409 the Alans led by Respendial settled in the provinces of Lusitania: "Alani Lusitaniam et Carthaginiensem provincias "
Jorge C. Arias thesis, Identity and Interaction: The Suevi and the Hispano-Romans, estimates the number of Alans in Iberia calculated in the literature as 30,000 to 40,000 people, so an organized influx of Caucasian DNA arriving in Western Iberia as a registered historical fact.
Portuguese Medieval genealogical records have names related to the Alans, like Mendo Alão (or Mendo Alam), a founding character of a Portuguese genealogical lineage and a mythical Armenian Princess too is present in the old legends.
Vestiges of the Alans in Portugal are also found in the legend of Coimbra's coat of arms, representing the Alan red lion and the Suebi green dragoon, according to Fray Bernardo de Brito in Monarquia Lusitana.
Respendial (Lusitania rex) was king of a group of Alans in Lusitania in the early 5th century CE.
Attaces, another Alan king in Lusitania (Ataces Lusitanae rex) was defeated and killed in battle with the Visigoths.
The first two kings in Lusitania were kings of Alan origin:
BERNARDO de Braga, O.S.B. ?-1605, Tratado sobre a precedencia do Reino de Portugal ao Reino de Napoles / composto por Frei Bernardo de Braga, copiado por Albano Antero da Silveira Pinto. - Porto : Typ. da Revista, 1843. - 54 p. ; 19 cm. - Copiado de um manuscrito autentico existente na Torre do Tombo
J1b M365+ in Western Iberia seems to be related to the Alan tribal migration of 409 and there's the possibility of a defined and recognizable haplotype (STR genetic signature) related to an Alan alpha male character in terms of a regular frequency and distribution in the modern Portuguese population.
More research is needed.

2008-08-17T08:24:00.000-07:00

Frequencies of J1b M365

The pioneer study of Semino et al (2004) found J1b M365 at rates of 1-2% in Turkey and Georgia.

As important as where a haplogroup/SNP is found, it's also very important where a haplogroup/SNP is not found.

No J1b M365 was ever found in Middle East populations of Arab and Jewish origins.

No J1b M365 was found in the Iranian sample analysed in Regueiro et al (2006).
Iran: Tricontinental Nexus for Y-Chromosome Driven Migration
Hum Hered 2006;61:132–143. DOI: 10.1159/000093774

No J1b M365 was ever found in North Africa

No J1b was found at any Spanish or Hispanic population (no one from the Castilian Meseta, Catalonia, Basque Country, Andalusia) with the exception of the already mentioned Western Iberian cases from Portugal and one case in Galicia.

No Portuguese Cristão Novo (Anusim) or Cigano (Gypsi, Gusmão et al. A Perspective on the History of the Iberian Gypsies Provided by Phylogeographic Analysis of Y-Chromosome Lineages) has been reported as J1b M365.

So up to date J1b M365 has been socially found only in samples from Anatolia-Caucasus and samples from Western Iberia-Portugal and in Portuguese colonists)

Map of J1b M365 cases:

http://tinyurl.com/5owkuh

2 SNP confirmed cases of J1b in 491 Portuguese samples in FTDNA 2/491 (jun/2008) and 2 cases of J1b (presumed haplotypes) in SMGF in 611 Brazilian samples 2/611 ! YHRD shows 2 cases (presumed haplotypes) in 68 Azoreans tested 2/68, and one J1b (presumed haplotype) in 244 Northern Portuguese samples 1/244 in Paula Sánchez-Diz et al. Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study. 674 haplotyes from Portugal+Brasil+Argentina in the Supplemental Material

The occurrence of M365+ in the Portuguese male population seems to be around 0,2-0,8%, because the Portuguese J1b modal haplotype with the characteristic J1 M365+ DNA signature (DYS393=13, 390=22, 19=15) has been found in almost every representative Portuguese DNA populational sample collected, what means a fraction of 0,2 to 0,8% of the total Portuguese Y DNA (45 millions) in Portugal (5 millions) and in Brazil (40 millions), what could perhaps be an indication of the J1b M365 contribution in the founding stages of the ethnogenesis of the Proto-Portuguese people, language and political organization 1500 years ago.

2008-08-16T05:48:00.000-07:00

Origins

M365 is a Y-chromosome single-nucleotide polymorphism (SNP).
M365 is classified as J1b by the International Society of Genetic Genealogy (ISOGG - 2008) and in Karafet et al, New Binary Polymorphisms Reshape and Increase Resolution of the Human Y-Chromosomal Haplogroup Tree. Abstract. Genome Research, published online April 2, 2008.

Family Tree DNAY Chromosome Browser

Name: M365
Type: snp
Source: M
Position: ChrY:2948678..2948678 (+ strand)
Length: 1
ISOGG_haplogroup: J1b
YCC_haplogroup: J1b
allele_anc: A
allele_der: G
primer_f: CCTTCATTTAGGCTGTAGCTGC
primer_r: TGTATCTTTAGTTGAGATGG
M365 class=Sequence position=ChrY:2948678..2948678 (+ strand)

M365 was first reported in this 2004 article:

Hum Genet (2004) 114 : 127–148
DOI 10.1007/s00439-003-1031-4

Excavating Y-chromosome haplotype strata in Anatolia
Cengiz Cinnioglu · Roy King · Toomas Kivisild ·
Ersi Kalfoglu · Sevil Atasoy · Gianpiero L. Cavalleri ·
Anita S. Lillie · Charles C. Roseman · Alice A. Lin ·
Kristina Prince · Peter J. Oefner · Peidong Shen ·
Ornella Semino · L. Luca Cavalli-Sforza ·
Peter A. Underhill

M365 was found in Eastern Anatolia

Marker - M365
Nucleotide change - A to G
Position -(bp) 246
Forward 5′→3′ ccttcatttaggctgtagctgc
Reverse 5′→3′ tgtatctttagttgagatgg
Total size (bp) - 274

Semino et al. 2004, observed J-M365 (in two Turks and one Georgian):

Am J Hum Genet. 2004 May; 74(5): 1023–1034.
Published online 2004 April 6.

Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and Later Migratory Events in the Mediterranean Area

Ornella Semino, Chiara Magri, Giorgia Benuzzi, Alice A. Lin, Nadia Al-Zahery, Vincenza Battaglia, Liliana Maccioni, Costas Triantaphyllidis, Peidong Shen, Peter J. Oefner, Lev A. Zhivotovsky, Roy King,3 Antonio Torroni, L. Luca Cavalli-Sforza, Peter A. Underhill, and A. Silvana Santachiara-Benerecetti1

J1b M365 cases were found in the following locations:

Turkish (Istanbul) (1/73) 1.4
Turkish (Konya) (1/129) .8
Georgian (1/45) 2.2

1 - Family Tree DNA database (august, 2008) there are only 4 individuals J1b M365+ SNP tested:

http://www.familytreedna.com/
http://www.familytreedna.com/public/Y-DNA_J/index.aspx?fixed_columns=on

Ancestor's locations of the FTDNA J1b's
Turnhout, Belgium - Cuylaerts
São Romão de Milhazes, Barcelos, Portugal - Oliveira
Orense, Galicia, Spain - Dominguez
São Miguel, Azores, Portugal - Sardinha

2 – Sorenson Molecular Genealogy Foundation- SMGF - J1b candidates
http://www.smgf.org/

There’s a group of J1b candidates from the Sorenson (SMGF) database. SMGF does not perform SNP tests.

Y Search code - name - location
R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF
6WQMH – Gonçalves – Imaruí, Santa Catarina, Brazil – SMGF
X6P7G – Ferrer – Reunion Island – SMGF. A Joachim Ferrere was the son of Custódio Ferreira, from Lisbon. Naissance : 11 mars 1726 à Lisbonne, PORTUGALDécès : 9 novembre 1787 à St Paul, REUNION, FRANCE http://www.ile-bourbon.net/hoarau/dat7.htm#14

So all 3 candidates are related to a Portuguese or Brazilian origin.

I have transfered the haplotypes to Y Search

R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF and
PRJ9T– Dominguez – Ourense, Galicia, Spain - J1b tested FTDNA matched 26/26 in 26 markers !

Genetic distance – markers/matches from PRJ9T Dominguez, J1b tested (FTDNA) :
8 - 67/59 to 2CUZQ, Oliveira J1b tested (FTDNA)
3 - 30/27 to 6WQMH Gonçalves (SMGF)
2 - 30/28 to X6P7G Ferrere (SMGF)
0 - 26/26 to R7SHE Cordeiro de Melo (SMGF)

3 - YHRD
http://www.yhrd.org/

STR database searching Y DNA J1b M365+ possible haplotypes:
M365 SNP tested FTDNA haplotypes :

DYS19- 389I – 389II – 390 – 391- 392 – 393 – 385a, 385b – 438 – 439
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Galicia, Spain
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Azores, Portugal

4 YHRD direct matches with YHRD haplotypes:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – YHRD - Rio de Janeiro, African 1/135
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68, total 2/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Kahramanmaras, Southern Turkey , Romani 1/111

1 SMGF haplotype:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 - SMGF - Gonçalves de Melo, Brazil

The same presumed J1b M365 haplotype matching 7 individuals (2 tested from FTDNA, 4 tested from YHRD and 1 tested from SMGF )

List of tested M365 J1b haplotypes:

2CUZQ - Oliveira - Sao Romao de Milhazes, Barcelos, Portugal - FTDNA - M365+ confirmed
PRJ9T - Dominguez - Castro, Ourense, Galicia, Spain - FTDNA - M365+ confirmed
E9YYJ - Cuylaerts - Turnhout, Belgium - FTDNA - M365+ confirmed
K3SMV - Sardinha - Ilha de São Miguel, Azores - FTDNA - M365+ confirmed
YTHMV - Haplotype - Cinnioglu et al article - Eastern Anatolia - M365+ confirmed

Presumed J1b haplotypes:

R7SHE - Cordeiro de Melo -Santana do Livramento, Rio Grande do Sul, Brazil - SMGF
6WQMH - Gonçalves - Imaruí, Santa Catarina, Brazil - SMGF
X6P7G - Ferrere - Reunion - SMGF
6URZK - YHRD possible M365 haplotypes - 4 individuals - Azores/Rio de Janeiro/Turkey
38EUZ - Haplotype 389 - Northern Portugal - Paula Sánchez-Diz et al article "Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study", 674 haplotyes from Portugal+Brasil+Argentina in the Supplemental Material

List of haplotypes:
http://tinyurl.com/6p2hem