Y DNA haplotypes and frequencies. The Portuguese-Brazilian J1b case

How can we find if a haplotype is considered as “established” or “outsider” in a given population?
It’s a question of frequency, perhaps. If a haplotype with a recognized genetic motif is present in any reliable sample of the population then we can infer that the haplotype is well distributed homogeneously in the population in a certain frequency. Even small frequencies of the order of 0,1 % can be detected and recognized in the case of big samples (<500). My case study is the frequency of the rare, but clearly visible J1b M365+ haplotypes in the Brazilian and Portuguese population. This genetic signature can be easily identified with the DYS19=15, DYS=390=22, DYS393=13 and a J1 signal like 458.2 or 388=16 what is a most probable way to capture a J1b haplotype.
In every big Portuguese and Brazilian databases (FTDNA, YHRD, SMGF) I can find the mentioned J1b motif provisory named as the “J1b Alan Modal Haplotype” in the Portuguese and Brazilian DNA stock. The frequency of the Portuguese J1b STR/SNP in the Portuguese population is estimated in between 0,2-0,8% of the total. The Portuguese Y DNA contribution to the Brazilian population has been estimated in circa de 40% (Sérgio Pena: 2000) what means 5 millions of Portuguese Y DNA in Portugal and 40 millions in Brazil. A haplotype will be considered as an established haplotype in a population if it’s found in a regular frequency in a constant and homogeneous participation in any big sample of this population. That’s the case of the J1b haplotype.
The article “Haplotype diversity of 17 Y-chromosome STRs in Brazilians”, Pereira et al, Forensic Science International 171 (2007) 226–236, lists 481 Brazilian haplotypes and there’s one identified as J1b, the number HP 406 with the “Alan Modal Haplotype”: DYS19=15, DYS=390=22, DYS393=13, the 458.2 and the rare DYS385I/II 12-20. So, just like the FTDNA, YHRD, SMGF databases, this article also keeps the regular statistical frequency of 0,2% of the Brazilian J1b haplotype.
The J1b haplotype participation in the Brazilian and Portuguese population must be related to its participation since the formation of the original stock of the Portuguese population during the “ethnogenesis age” of the creation of this distinct population organized around the Minho and Douro rivers 1500 years ago (Hispano-Romans, Suebis, Alans coalescence in the Minho-Coimbra area). That’s the same chronology of the formation of the Portuguese language as a distinct and organized language. The consequence of a distinct community organized as a distinct society with a specific language led to the creation of hierarchies, social stratifications and finally led to the creation of the independent Portuguese National State around the 12th century as a response to the Moor Almoravid and Almohad onslaught of the 11th century. In the last thousand years the Portuguese population had gone through two bottlenecks, one around the year 1000 AD with the Moor pressure and the other in the Thirty Years War (1630-1654) with the Castilian pressure in Iberia and the Dutch pressure in Brazil, in both cases the threats of annihilation of the autonomy and existence of this population in Europe and in America led to a situation of total war and a subsequent victory with a new demographic boom of the Portuguese-Brazilian population in new conquered territories. The original male population of the Entre Douro e Minho with a population of perhaps 30.000 Y DNA around the year 1000 AD has multiplied to a half a million in 1500 and to 45 millions nowadays. The Minho little population with few resources has been able to conquer Portugal and then conquer one of the world big territories in Brazil to become one of the world’s “Monster Country”. So the calculated total number of J1b’s haplotypes in the Portuguese-Brazilian population (from 0,2 to 0,8%) of the total population (45 millions) could be between 90.000 and 360.000. A single male, the J1b Western Iberian Genearch perhaps coming in the Alan invasion, was the founder of this lineage. Would it be possible to guess any kind of social status of his position after a thousand of years ? That’s a difficult question but somehow this Eastern Anatolian/Caucasian/Caspian “exotic” Y DNA could survive and thrive in a completely different place in the westernmost part of Western Europe, in times of war and destruction, in a very distant population very far way from the place of the original source and original habitat of this SNP and in a completely different hostile haplogroup environment. What I can say is that most probably this haplotype had entered the Portuguese stock before or just at the exact foundational moment of the ethnogenesis of the Portuguese population because it’s well rooted in some deep rural traditional places of the Minho and it is very well homogeneously distributed with a regular frequency in every big sample of the Portuguese and Brazilian population. The J1b haplotype was not observed in the recent article “The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula”. No Hispanic populations of Castilian, Catalan, Basque languages of Iberia and no Sephardic, Jew, Moor, Arab or North African population has presented this haplotype. The J1b M365+ is a Western Iberian-Portuguese-Brazilian phenomenon.

The American Journal of Human Genetics 04 December 2008
doi:10.1016/j.ajhg.2008.11.007
The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
Supplemental Data for M. Adams et al.

http://www.cell.com/AJHG/supplemental/S0002-9297(08)00592-2

Haplotype diversity of 17 Y-chromosome STRs in Brazilians .
Forensic Science International , Volume 171 , Issue 2 - 3 , Pages 226 - 236
R . Pereira , E . Monteiro , G . Hirschfeld , A . Wang , D . Grattapaglia

List of J1b haplotypes and candidates with the new Brazilian HP406 haplotype:

http://tinyurl.com/5bg4f4

Ricardo Costa de Oliveira

Legends of the nomadic Iranian speaking tribes in Eurasia

- England and Japan

C. Scott Littleton, Occidental College, Los Angeles
Yarnato-takeru: An "Arthurian" Hero in Japanese Tradition

"The curious similarities between the legendary Japanese hero Yamato-takeru and King Arthur do not appear to be merely fortuitous. We now know that between the second and the fifth centuries A.D. the folklore of both Japan and Western Europe was influenced-both directly and indirectly - by that of several nomadic Northeast Iranian speaking tribes (Sarmatians, Alans, etc.). These tribes originated in the steppes of what is today southern Russia and the Ukraine. The last surviving Northeast Iranian speakers,the Ossetians of the north-central Caucasus, preserve a corpus of legends about a hero called Batraz who closely resembles both Yamato-takeru and Arthur. It is suggested that Yamato-takeru, Arthur, and Batraz derive from a common Northeast Iranian prototype".

Asian Folklore Studies, Volume 54, 1995: 259-274
http://www.nanzan-u.ac.jp/SHUBUNKEN/publications/afs/pdf/a1074.pdf

-Portugal

Manuscript of Fray Bernardo de Braga (?-1605) “Sobre a precedência do reino de Portugal, ao reino de Nápoles”
http://tinyurl.com/64lpt2
The first king of Lusitania was Respendial (Rapantiano, Rapantianus) and the second was Ataces (Atacces, Adax) Lusitania rex. One of the first kings in Western Europe after the Roman Empire, the idea of a warrior king as an Eastern Iranian cultural import in the Western Atlantic façade ?
« Rapantianus Lusitaniam a Romanis capessit , fuit « Alanus quidem et Lusitania rex, sed breviter a suis « occisus successit Atacius, qui ultra Lusitaniam « suum Regnum dilatavit,... «
“Resplamdiano Alanorun Regi defuncto successit Atax”.
Coimbra was the capital of the Alan Kingdom of Lusitania and the King Ataces was killed in battle against the Visigoths. 1156 years later another Portuguese King, successor of the Alan Kings from Lusitania, was killed again in battle, Dom Sebastião killed in action in Alcacer Quibir, 4 of august of 1578, in North Africa. D. Sebastião took the sword of Afonso Henriques, the first Portuguese King from the Santa Cruz Monastery, in Coimbra.

The kings as warrior knights, the symbolic swords and the messianic figure of the lost kings are common elements.
In some cases DNA and legends can travel together and they can make difference far away from the point of origin. Kings had knights and troops with them, perhaps some remnant elements of this DNA “gesta” can be found nowadays in some parts of Eurasia. Rare Exotic Y DNA matching haplotypes in the Caucasus, Iran and in Portugal can be very good candidates for this kind of gesta in the Portuguese case.

Alan Influence in Western Iberia

"The continued existence of several Alan place names in Spain also suggests that Alan influence was not completely erased by Visigothic domination. As late as 575 Orense, a part of Galicia where the Alans are known to have flourished with imperial support until about 428-429, was controlled by a senior loci with the very Alan-sound name of Aspidius. The asp- element derives from the Iranian word from horse as exemplified in the name of the famous East Roman Alan general Aspar. Aspidius may have been a Latinized form of the Iranian name or perhaps of the name as they appear in the Greek form"Bachrach: 1973, 98
A History of the Alans in the West: From Their First Appearance in the Sources of Classical Antiquity Through the Early Middle Ages. Bernard S. Bachrach. U of Minnesota Press, 1973ISBN 0816606781, 978081660678.8

http://books.google.com.br/books?id=SXER_fLym9kC&pg=PA98&dq=Aspidius&lr=#PPA98,M1

Manuel Alberro supports this idea in his article “Los Alanos in Gallaecia …” (Gallaecia, Year 2004, N° 23, 301-329). (John Biclar, Chron.,s,a. 575, Thompson 1962:62)
http://dialnet.unirioja.es/servlet/articulo?codigo=963590

Isn’t it a coincidence that the only J1b M365+ found in Galicia, the only one found in NW Spain is located exactly in… Ourense (or Orense) ! (FTDNA, 82640)
http://www.familytreedna.com/public/Y-DNA_J/index.aspx?fixed_columns=on

In the Cambridge Medieval History, Volume II, 1913 Aspidius is even quoted as “King”.“that mountainous district known as Aregenses, situated in what is now the province of Orense, and of which a certain Aspidius was king” A group of Alans settled in Northern Gaul. Sources on the Alans: A Critical Compilation. Agustí Alemany. BRILL, 2000. Could be the distant origin of the Belgium case of J1b M365+ ?
And the bulk of the Iberian Alans settled in Lusitania under the command of Respendial and Attaces, “Lusitania Rex” and could be the explanation of the Portuguese J1b M365+ cases around the world. Given the distribution of the Portuguese J1b haplotypes, that could be perhaps an indication of an Iranian speaking Alan genetic signature associated or not to some cases of alpha males or just fellow travellers in Western Iberia ? The first idea of a Kingdom in Western Iberia (even in Western Europe after the Roman Empire) would be an invention of the Alans. BERNARDO de Braga, O.S.B. ?-1605, Tratado sobre a precedencia do Reino de Portugal ao Reino de Napoles.
http://books.google.com.br/books?id=9bYRAAAAYAAJ&pg=RA2-

A haplotype with absolutely no Y DNA matches and absolutely no recent ancestral origins listed at the FTDNA database (any other case has been found xJ1b?) can be considered rare and unique and it's the obvious result of a rare and unique event because in the last 4000 years almost all clusters and haplotypes have experienced a kind of star like growth distributed over contiguous territories with different frequencies. When I see that there are some haplotypes with hundreds or even thousands of matches at the databases I realize that my haplotype is unique and rare and most probably it's associated to a unique and rare event that was the opening of a passage (a dimensional portal) between Eastern Anatolia/the Caucasus/the Caspian Sea and Western Iberia in another extreme of Europe. All other J haplotypes and clades are more or less evenly distributed in a contiguous area with a regular gradient of genetic distances. A haplotype generally has a continuum matching of haplotypes in terms of genetic distances in a territorial continuum of frequencies. If you can't find matches and there's not a territorial continuity then the haplotype must be associated to a rare and unique event that caused its existence in completely different and distant small hot spots. The Central Arena of Eurasia is the circle between Anatolia-Armenia-Caucasus and the Northern Levant, that's a tough space to survive and prevail and no Y DNA haplogroup or language could be hegemonic there for a long time. Probably the only possible dimensional gate that linked Western Iberia with this Central Arena was the rare and unique event of the Hunnic invasions and the Fall of the Western Roman Empire, when a fierce group could cross the entire continent of Europe from one edge to another. If my calculus is correct J1b shall be found in small rural and remotes places in Western Iberia and in the Brazilian demographic boom of the last centuries where finally J1b has found a big new world full of space.



Alan Light Cavalry in an imaginary representation
Pro Deo et Rege

So It seems that J1b M365+ does not like the Mediterranean Sea

No J1b M365 known haplotype (DYS393=13, DYS390=22, DYS19=15) has ever been found in the Mediterranean populations databases. Not only in the FTDNA Projects, including the J Project, neither in several scientific articles with supplemental data.

That's also a case of negative validation, No J1b haplotype was found in these articles:

- Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean. Pierre A. Zalloua et al (2008)
http://www.cell.com/AJHG/fulltext/S0002-9297(08)00547-8
- Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample. C. Robino et al (2008)
- Y-chromosomal STR haplotypes in Berber and Arabic-speaking populations from Morocco. Forensic Sci Int. 140:113–115. Quintana-Murci L, Bigham A, Rouba H, Barakat A, McElreavey
K, Hammer M (2004)
- The Y chromosome pool of Jews as part of the genetic landscape of the Middle East. Am J Hum Genet 69:1095–1112. Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M,
Oppenheim A (2001)

Animals as Fellow Travellers

'Viking mouse' invasion tracked, BBC noticed this week
http://news.bbc.co.uk/2/hi/science/nature/7645908.stm
"What this suggests to us is that the Norwegian Vikings were taking these mice around and they were taking a particular genetic type; because there are all sorts of genetic types and the particular type that happened to be where the first Vikings picked them up is the one that got spread around."

Geneticists could also track the supposed "Alan's dog"

The Spanish Alano today is a legacy of the Alan tribe which entered the Iberian Peninsula with the Vandal hordes during the early part of the 5th Century. The Alani were one of the Sarmatian peoples which inhabited the plains along the River Don to the northeast of the Sea of Azov in modern-day Russia. Formidable horsemen and skilled bowmen, these warring nomads were also famous for their dogs

http://en.wikipedia.org/wiki/Alano_Espa%C3%B1ol

Molosser

http://en.wikipedia.org/wiki/Molosser

Alaunt

http://en.wikipedia.org/wiki/Alaunt

"Paul Strang, a cynologist and a noted authority on the Great Pyrenees, observes in his book "The Complete Great Pyrenees", that the existence of massive native breeds today in Turkey, Iran, and Southern Russia could support the theory that the ancestors of today's mastiff breeds came from the Middle East. Other serious cynologists, such as David and Judy Nelson, agree with that possibility. Remains of domestic dogs from 5500 years ago have discovered in many parts of Iran of today. But the territory of Iran of today is not the same lands of old Persia which was much bigger and included the lands from India in east to Greece in west. Even the areas of southern Russia and the central Asia of today (Caucas, Azerbaijan, Armenia, Georgia and...) or better to say the origin area of Mid. Asian and Caucasian shepherds were the Iranian territories and passed to Russia after peace between the two countries, just about 100 years ago. These areas were the "lands of mastiffs" for thousands of years. Four kinds of old Persian dogs were reported by the classical authors" (Source: Persian Mastiffs a brief historical summary about the ancient mastiffs of Iran)



http://irandogs.110mb.com/breeds/mastiff/mastif.html

Hyrcanian Mastiff, "Lion dog"



Brazilian Fila (Fila Brasileiro), also known as Brazilian Mastyff



The Fila Brasileiro is believed to have been developed from a number of breeds, predominantly the Mastiff, the Bulldog and the Bloodhound (the last contributing to breed's loose skin). The Fila Brasileiros were found primarily on large plantations and cattle farms from where they originated. Reportedly, they are also excellent tracking dogs and were used to track slaves and fugitives

http://en.wikipedia.org/wiki/Fila_Brasileiro

Hyrcania, New-Found Connection

October's YHRD new release of haplotypes revealed samples of DNA from the Southern Caspian Sea peoples, a region known in ancient times as Hyrcania, the ancient state in the north of Iran . The southern shores of the Caspian Sea (Hyrcanian Sea) are the Iranian provinces of Gilan and Mazandaran.





Wiki

The J1b M365+ "genetic signature" (the distinct DYS 393=13, 390=22, 19=15 and the J1 indicator 458=18,2) has been found there:

1/47 (one in 47 tested) - Rasht, Gilaki, Iran
1/50 (one in 50 tested)- Sari, Mazandarani, Iran


19 – 389I – 389II – 390 – 391 – 392 – 393 – 385 – 438 – 439 – 437 – 448 - -456 – 458 – 635– GATA H4:
15 – 13 – 29 – 22 – 10 – 11 – 13 – 12,20 – 10 – 11 – 14 – 20 – 15 – 18,2 – 21 -10 Rasht, Gilaki, Iran
15 – 13 – 29 – 22 – 10 – 11 – 13 – 12,12 – 10 – 11 – 14 – 20 – 15 – 18,2 – 20 -10 Sari, Mazandarani, Iran

I keep the Alan’s hypothesis as the source of J1b presence in Portugal and in Brazil, the Alans were an Iranian nomadic group !

The Alans have been in Hyrcania, according to Josephus:


Now there was a nation of the Alans, which we have formerly mentioned some where as being Scythians and inhabiting at the lake Meotis. This nation about this time laid a design of falling upon Media, and the parts beyond it, in order to plunder them; with which intention they treated with the king of Hyrcania; for he was master of that passage which king Alexander [the Great] shut up with iron gates. This king gave them leave to come through them; so they came in great multitudes, and fell upon the Medes unexpectedly, and plundered their country, which they found full of people, and replenished with abundance of cattle, while nobody durst make any resistance against them; for Paeorus, the king of the country, had fled away for fear into places where they could not easily come at him, and had yielded up every thing he had to them, and had only saved his wife and his concubines from them, and that with difficulty also, after they had been made captives, by giving them a hundred talents for their ransom. These Alans therefore plundered the country without opposition, and with great ease, and proceeded as far as Armenia, laying all waste before them


http://www.sacred-texts.com/jud/josephus/war-7.htm


What is remarkable is that apparently J1b M365+ can be found only in regions impacted and crossed by the Alans. The genetic distance of all haplotypes is relatively tightly closed from Hyrcania to old Roman Gallaecia in Northwestern Iberia, almost the same haplotype covering big geographical distances and centuries of separation from the common tribal source, but showing little genetic distance revealing a recognizable distinct homogeneous pattern with minimal differences in spite of the space and ages trekked.

Up-to-dated Haplotypes:

http://tinyurl.com/3qwytu

Up-to-dated J1b Map

http://tinyurl.com/5owkuh

Crossroads, Eastern Anatolia, J1b M365 Land

Eastern Anatolia is the place where J1b M365 was first reported and probably is the historical core of this genetic genealogical marker.

Anatolia history is full of civilizations since the advent of the neolithic and the creation of the first states in the region. J1b M365 has seen historical actions in the following events that took part in Eastern Anatolia:

1 -The Roman frontline against the Alans in 135 AD, as described by Arrianus:

Source:

http://members.tripod.com/~S_van_Dorst/Ancient_Warfare/Rome/Sources/ektaxis.html

http://www.satrapa1.com/articulos/antiguedad/Alanos/arriano_alanos.htm

2 - Urartu, the mysterious Kingdom

Source:

http://www.satrapa1.com/articulos/antiguedad/oriente/atlasoriente.htm

3 - The even more mysterious Cimmerians

Source:

http://en.wikipedia.org/wiki/Cimmerians

If only DNA could speak !

Artistic representation of the "Crossing of the Rhine", a mixed band of Vandals, Alans and Suebi crossed the frozen Rhine at Mainz on December 31, 406, and began to ravage Gaul and Iberia.




Suebi flag as described by Fray Bernardo de Braga and Fray Bernardo de Brito





Ossetian coat of arms




Coimbra coat of arms

Red Lion of Alan origin

Interpretations

How could J1b arrive to Western Iberia ?
In terms of geographical curiosity J1b M365 linked Eastern and Western Iberia !

J1 M267 in Western Iberia could be related to several Eastern migrations or invasions since Prehistory. Iberomaurusian groups coming before the Neolithic, groups coming with the Neolithization of the Peninsula, groups arriving with early seafarers from Phoenicia or from Greece, Jews or Arabs could have brought some of the J1 M267 to Western Iberia. Every hypothesis is possible and must be tested.

The only organized migratory wave of people to Lusitania and Western Iberia coming from Eastern Anatolia and the Caucasus is the Alan movement in the fall of the Roman Empire.

One of the best compilations about the Alans is the book "Sources on the Alans" written by Agustí Alemany. Hydatius bishop of Aquae Flaviae (modern Chaves) wrote that in 409 the Alans led by Respendial settled in the provinces of Lusitania: "Alani Lusitaniam et Carthaginiensem provincias "
Jorge C. Arias thesis, Identity and Interaction: The Suevi and the Hispano-Romans, estimates the number of Alans in Iberia calculated in the literature as 30,000 to 40,000 people, so an organized influx of Caucasian DNA arriving in Western Iberia as a registered historical fact.
Portuguese Medieval genealogical records have names related to the Alans, like Mendo Alão (or Mendo Alam), a founding character of a Portuguese genealogical lineage and a mythical Armenian Princess too is present in the old legends.
Vestiges of the Alans in Portugal are also found in the legend of Coimbra's coat of arms, representing the Alan red lion and the Suebi green dragoon, according to Fray Bernardo de Brito in Monarquia Lusitana.
Respendial (Lusitania rex) was king of a group of Alans in Lusitania in the early 5th century CE.
Attaces, another Alan king in Lusitania (Ataces Lusitanae rex) was defeated and killed in battle with the Visigoths.
The first two kings in Lusitania were kings of Alan origin:
BERNARDO de Braga, O.S.B. ?-1605, Tratado sobre a precedencia do Reino de Portugal ao Reino de Napoles / composto por Frei Bernardo de Braga, copiado por Albano Antero da Silveira Pinto. - Porto : Typ. da Revista, 1843. - 54 p. ; 19 cm. - Copiado de um manuscrito autentico existente na Torre do Tombo
J1b M365+ in Western Iberia seems to be related to the Alan tribal migration of 409 and there's the possibility of a defined and recognizable haplotype (STR genetic signature) related to an Alan alpha male character in terms of a regular frequency and distribution in the modern Portuguese population.
More research is needed.

Frequencies of J1b M365

The pioneer study of Semino et al (2004) found J1b M365 at rates of 1-2% in Turkey and Georgia.

As important as where a haplogroup/SNP is found, it's also very important where a haplogroup/SNP is not found.

No J1b M365 was ever found in Middle East populations of Arab and Jewish origins.

No J1b M365 was found in the Iranian sample analysed in Regueiro et al (2006).
Iran: Tricontinental Nexus for Y-Chromosome Driven Migration
Hum Hered 2006;61:132–143. DOI: 10.1159/000093774

No J1b M365 was ever found in North Africa

No J1b was found at any Spanish or Hispanic population (no one from the Castilian Meseta, Catalonia, Basque Country, Andalusia) with the exception of the already mentioned Western Iberian cases from Portugal and one case in Galicia.

No Portuguese Cristão Novo (Anusim) or Cigano (Gypsi, Gusmão et al. A Perspective on the History of the Iberian Gypsies Provided by Phylogeographic Analysis of Y-Chromosome Lineages) has been reported as J1b M365.

So up to date J1b M365 has been socially found only in samples from Anatolia-Caucasus and samples from Western Iberia-Portugal and in Portuguese colonists)

Map of J1b M365 cases:

http://tinyurl.com/5owkuh

2 SNP confirmed cases of J1b in 491 Portuguese samples in FTDNA 2/491 (jun/2008) and 2 cases of J1b (presumed haplotypes) in SMGF in 611 Brazilian samples 2/611 ! YHRD shows 2 cases (presumed haplotypes) in 68 Azoreans tested 2/68, and one J1b (presumed haplotype) in 244 Northern Portuguese samples 1/244 in Paula Sánchez-Diz et al. Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study. 674 haplotyes from Portugal+Brasil+Argentina in the Supplemental Material

The occurrence of M365+ in the Portuguese male population seems to be around 0,2-0,8%, because the Portuguese J1b modal haplotype with the characteristic J1 M365+ DNA signature (DYS393=13, 390=22, 19=15) has been found in almost every representative Portuguese DNA populational sample collected, what means a fraction of 0,2 to 0,8% of the total Portuguese Y DNA (45 millions) in Portugal (5 millions) and in Brazil (40 millions), what could perhaps be an indication of the J1b M365 contribution in the founding stages of the ethnogenesis of the Proto-Portuguese people, language and political organization 1500 years ago.

Origins

M365 is a Y-chromosome single-nucleotide polymorphism (SNP).
M365 is classified as J1b by the International Society of Genetic Genealogy (ISOGG - 2008) and in Karafet et al, New Binary Polymorphisms Reshape and Increase Resolution of the Human Y-Chromosomal Haplogroup Tree. Abstract. Genome Research, published online April 2, 2008.

Family Tree DNAY Chromosome Browser


Name: M365
Type: snp
Source: M
Position: ChrY:2948678..2948678 (+ strand)
Length: 1
ISOGG_haplogroup: J1b
YCC_haplogroup: J1b
allele_anc: A
allele_der: G
primer_f: CCTTCATTTAGGCTGTAGCTGC
primer_r: TGTATCTTTAGTTGAGATGG
M365 class=Sequence position=ChrY:2948678..2948678 (+ strand)

M365 was first reported in this 2004 article:

Hum Genet (2004) 114 : 127–148
DOI 10.1007/s00439-003-1031-4

Excavating Y-chromosome haplotype strata in Anatolia
Cengiz Cinnioglu · Roy King · Toomas Kivisild ·
Ersi Kalfoglu · Sevil Atasoy · Gianpiero L. Cavalleri ·
Anita S. Lillie · Charles C. Roseman · Alice A. Lin ·
Kristina Prince · Peter J. Oefner · Peidong Shen ·
Ornella Semino · L. Luca Cavalli-Sforza ·
Peter A. Underhill

M365 was found in Eastern Anatolia

Marker - M365
Nucleotide change - A to G
Position -(bp) 246
Forward 5′→3′ ccttcatttaggctgtagctgc
Reverse 5′→3′ tgtatctttagttgagatgg
Total size (bp) - 274

Semino et al. 2004, observed J-M365 (in two Turks and one Georgian):

Am J Hum Genet. 2004 May; 74(5): 1023–1034.
Published online 2004 April 6.

Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and Later Migratory Events in the Mediterranean Area

Ornella Semino, Chiara Magri, Giorgia Benuzzi, Alice A. Lin, Nadia Al-Zahery, Vincenza Battaglia, Liliana Maccioni, Costas Triantaphyllidis, Peidong Shen, Peter J. Oefner, Lev A. Zhivotovsky, Roy King,3 Antonio Torroni, L. Luca Cavalli-Sforza, Peter A. Underhill, and A. Silvana Santachiara-Benerecetti1

J1b M365 cases were found in the following locations:

Turkish (Istanbul) (1/73) 1.4
Turkish (Konya) (1/129) .8
Georgian (1/45) 2.2

1 - Family Tree DNA database (august, 2008) there are only 4 individuals J1b M365+ SNP tested:

http://www.familytreedna.com/
http://www.familytreedna.com/public/Y-DNA_J/index.aspx?fixed_columns=on

Ancestor's locations of the FTDNA J1b's
Turnhout, Belgium - Cuylaerts
São Romão de Milhazes, Barcelos, Portugal - Oliveira
Orense, Galicia, Spain - Dominguez
São Miguel, Azores, Portugal - Sardinha

2 – Sorenson Molecular Genealogy Foundation- SMGF - J1b candidates
http://www.smgf.org/

There’s a group of J1b candidates from the Sorenson (SMGF) database. SMGF does not perform SNP tests.

Y Search code - name - location
R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF
6WQMH – Gonçalves – Imaruí, Santa Catarina, Brazil – SMGF
X6P7G – Ferrer – Reunion Island – SMGF. A Joachim Ferrere was the son of Custódio Ferreira, from Lisbon. Naissance : 11 mars 1726 à Lisbonne, PORTUGALDécès : 9 novembre 1787 à St Paul, REUNION, FRANCE http://www.ile-bourbon.net/hoarau/dat7.htm#14

So all 3 candidates are related to a Portuguese or Brazilian origin.

I have transfered the haplotypes to Y Search

R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF and
PRJ9T– Dominguez – Ourense, Galicia, Spain - J1b tested FTDNA matched 26/26 in 26 markers !

Genetic distance – markers/matches from PRJ9T Dominguez, J1b tested (FTDNA) :
8 - 67/59 to 2CUZQ, Oliveira J1b tested (FTDNA)
3 - 30/27 to 6WQMH Gonçalves (SMGF)
2 - 30/28 to X6P7G Ferrere (SMGF)
0 - 26/26 to R7SHE Cordeiro de Melo (SMGF)

3 - YHRD
http://www.yhrd.org/

STR database searching Y DNA J1b M365+ possible haplotypes:
M365 SNP tested FTDNA haplotypes :

DYS19- 389I – 389II – 390 – 391- 392 – 393 – 385a, 385b – 438 – 439
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Galicia, Spain
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Azores, Portugal

4 YHRD direct matches with YHRD haplotypes:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – YHRD - Rio de Janeiro, African 1/135
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68, total 2/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Kahramanmaras, Southern Turkey , Romani 1/111

1 SMGF haplotype:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 - SMGF - Gonçalves de Melo, Brazil

The same presumed J1b M365 haplotype matching 7 individuals (2 tested from FTDNA, 4 tested from YHRD and 1 tested from SMGF )

List of tested M365 J1b haplotypes:

2CUZQ - Oliveira - Sao Romao de Milhazes, Barcelos, Portugal - FTDNA - M365+ confirmed
PRJ9T - Dominguez - Castro, Ourense, Galicia, Spain - FTDNA - M365+ confirmed
E9YYJ - Cuylaerts - Turnhout, Belgium - FTDNA - M365+ confirmed
K3SMV - Sardinha - Ilha de São Miguel, Azores - FTDNA - M365+ confirmed
YTHMV - Haplotype - Cinnioglu et al article - Eastern Anatolia - M365+ confirmed

Presumed J1b haplotypes:

R7SHE - Cordeiro de Melo -Santana do Livramento, Rio Grande do Sul, Brazil - SMGF
6WQMH - Gonçalves - Imaruí, Santa Catarina, Brazil - SMGF
X6P7G - Ferrere - Reunion - SMGF
6URZK - YHRD possible M365 haplotypes - 4 individuals - Azores/Rio de Janeiro/Turkey
38EUZ - Haplotype 389 - Northern Portugal - Paula Sánchez-Diz et al article "Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study", 674 haplotyes from Portugal+Brasil+Argentina in the Supplemental Material

List of haplotypes:
http://tinyurl.com/6p2hem