Origins

M365 is a Y-chromosome single-nucleotide polymorphism (SNP).
M365 is classified as J1b by the International Society of Genetic Genealogy (ISOGG - 2008) and in Karafet et al, New Binary Polymorphisms Reshape and Increase Resolution of the Human Y-Chromosomal Haplogroup Tree. Abstract. Genome Research, published online April 2, 2008.

Family Tree DNAY Chromosome Browser


Name: M365
Type: snp
Source: M
Position: ChrY:2948678..2948678 (+ strand)
Length: 1
ISOGG_haplogroup: J1b
YCC_haplogroup: J1b
allele_anc: A
allele_der: G
primer_f: CCTTCATTTAGGCTGTAGCTGC
primer_r: TGTATCTTTAGTTGAGATGG
M365 class=Sequence position=ChrY:2948678..2948678 (+ strand)

M365 was first reported in this 2004 article:

Hum Genet (2004) 114 : 127–148
DOI 10.1007/s00439-003-1031-4

Excavating Y-chromosome haplotype strata in Anatolia
Cengiz Cinnioglu · Roy King · Toomas Kivisild ·
Ersi Kalfoglu · Sevil Atasoy · Gianpiero L. Cavalleri ·
Anita S. Lillie · Charles C. Roseman · Alice A. Lin ·
Kristina Prince · Peter J. Oefner · Peidong Shen ·
Ornella Semino · L. Luca Cavalli-Sforza ·
Peter A. Underhill

M365 was found in Eastern Anatolia

Marker - M365
Nucleotide change - A to G
Position -(bp) 246
Forward 5′→3′ ccttcatttaggctgtagctgc
Reverse 5′→3′ tgtatctttagttgagatgg
Total size (bp) - 274

Semino et al. 2004, observed J-M365 (in two Turks and one Georgian):

Am J Hum Genet. 2004 May; 74(5): 1023–1034.
Published online 2004 April 6.

Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and Later Migratory Events in the Mediterranean Area

Ornella Semino, Chiara Magri, Giorgia Benuzzi, Alice A. Lin, Nadia Al-Zahery, Vincenza Battaglia, Liliana Maccioni, Costas Triantaphyllidis, Peidong Shen, Peter J. Oefner, Lev A. Zhivotovsky, Roy King,3 Antonio Torroni, L. Luca Cavalli-Sforza, Peter A. Underhill, and A. Silvana Santachiara-Benerecetti1

J1b M365 cases were found in the following locations:

Turkish (Istanbul) (1/73) 1.4
Turkish (Konya) (1/129) .8
Georgian (1/45) 2.2

1 - Family Tree DNA database (august, 2008) there are only 4 individuals J1b M365+ SNP tested:

http://www.familytreedna.com/
http://www.familytreedna.com/public/Y-DNA_J/index.aspx?fixed_columns=on

Ancestor's locations of the FTDNA J1b's
Turnhout, Belgium - Cuylaerts
São Romão de Milhazes, Barcelos, Portugal - Oliveira
Orense, Galicia, Spain - Dominguez
São Miguel, Azores, Portugal - Sardinha

2 – Sorenson Molecular Genealogy Foundation- SMGF - J1b candidates
http://www.smgf.org/

There’s a group of J1b candidates from the Sorenson (SMGF) database. SMGF does not perform SNP tests.

Y Search code - name - location
R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF
6WQMH – Gonçalves – Imaruí, Santa Catarina, Brazil – SMGF
X6P7G – Ferrer – Reunion Island – SMGF. A Joachim Ferrere was the son of Custódio Ferreira, from Lisbon. Naissance : 11 mars 1726 à Lisbonne, PORTUGALDécès : 9 novembre 1787 à St Paul, REUNION, FRANCE http://www.ile-bourbon.net/hoarau/dat7.htm#14

So all 3 candidates are related to a Portuguese or Brazilian origin.

I have transfered the haplotypes to Y Search

R7SHE - Cordeiro de Melo – Santana do Livramento, Rio Grande do Sul, Brazil – SMGF and
PRJ9T– Dominguez – Ourense, Galicia, Spain - J1b tested FTDNA matched 26/26 in 26 markers !

Genetic distance – markers/matches from PRJ9T Dominguez, J1b tested (FTDNA) :
8 - 67/59 to 2CUZQ, Oliveira J1b tested (FTDNA)
3 - 30/27 to 6WQMH Gonçalves (SMGF)
2 - 30/28 to X6P7G Ferrere (SMGF)
0 - 26/26 to R7SHE Cordeiro de Melo (SMGF)

3 - YHRD
http://www.yhrd.org/

STR database searching Y DNA J1b M365+ possible haplotypes:
M365 SNP tested FTDNA haplotypes :

DYS19- 389I – 389II – 390 – 391- 392 – 393 – 385a, 385b – 438 – 439
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Galicia, Spain
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – FTDNA – M365+ Azores, Portugal

4 YHRD direct matches with YHRD haplotypes:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 – YHRD - Rio de Janeiro, African 1/135
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Azores 1/68, total 2/68
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – ** – ** - YHRD – Kahramanmaras, Southern Turkey , Romani 1/111

1 SMGF haplotype:
15 – 13 - 29 – 22 - 10 - 11 – 13 – 12,19 – 10 – 11 - SMGF - Gonçalves de Melo, Brazil

The same presumed J1b M365 haplotype matching 7 individuals (2 tested from FTDNA, 4 tested from YHRD and 1 tested from SMGF )

List of tested M365 J1b haplotypes:

2CUZQ - Oliveira - Sao Romao de Milhazes, Barcelos, Portugal - FTDNA - M365+ confirmed
PRJ9T - Dominguez - Castro, Ourense, Galicia, Spain - FTDNA - M365+ confirmed
E9YYJ - Cuylaerts - Turnhout, Belgium - FTDNA - M365+ confirmed
K3SMV - Sardinha - Ilha de São Miguel, Azores - FTDNA - M365+ confirmed
YTHMV - Haplotype - Cinnioglu et al article - Eastern Anatolia - M365+ confirmed

Presumed J1b haplotypes:

R7SHE - Cordeiro de Melo -Santana do Livramento, Rio Grande do Sul, Brazil - SMGF
6WQMH - Gonçalves - Imaruí, Santa Catarina, Brazil - SMGF
X6P7G - Ferrere - Reunion - SMGF
6URZK - YHRD possible M365 haplotypes - 4 individuals - Azores/Rio de Janeiro/Turkey
38EUZ - Haplotype 389 - Northern Portugal - Paula Sánchez-Diz et al article "Population and segregation data on 17 Y-STRs: results of a GEP-ISFG collaborative study", 674 haplotyes from Portugal+Brasil+Argentina in the Supplemental Material

List of haplotypes:
http://tinyurl.com/6p2hem